ID: 1128991043

View in Genome Browser
Species Human (GRCh38)
Location 15:72260567-72260589
Sequence TACCATGAAGAACCCCAAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128991043_1128991048 21 Left 1128991043 15:72260567-72260589 CCACTTTGGGGTTCTTCATGGTA 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1128991048 15:72260611-72260633 AGGCGCCCAACCCGAAGCTCTGG 0: 1
1: 0
2: 2
3: 7
4: 72
1128991043_1128991047 1 Left 1128991043 15:72260567-72260589 CCACTTTGGGGTTCTTCATGGTA 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1128991047 15:72260591-72260613 AGGAGATGGAACGGTTCATGAGG 0: 1
1: 0
2: 0
3: 4
4: 129
1128991043_1128991046 -8 Left 1128991043 15:72260567-72260589 CCACTTTGGGGTTCTTCATGGTA 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1128991046 15:72260582-72260604 TCATGGTACAGGAGATGGAACGG 0: 1
1: 0
2: 0
3: 25
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128991043 Original CRISPR TACCATGAAGAACCCCAAAG TGG (reversed) Exonic
903760442 1:25694354-25694376 GACCATGAGGAGCCCCAAATTGG + Intronic
907430279 1:54407091-54407113 TACTTTGGAAAACCCCAAAGTGG + Intronic
907456352 1:54578760-54578782 TACCATTTGGAAGCCCAAAGAGG + Intronic
909889777 1:80990264-80990286 TAACAGCAAGAACCCCAGAGAGG - Intergenic
911897595 1:103456856-103456878 TACCATGTAGTAACCAAAAGAGG + Intergenic
915019675 1:152767131-152767153 TACCATGGAAACCCACAAAGGGG + Intronic
916403280 1:164471756-164471778 TACTATGAAGAACCCTCAAAGGG + Intergenic
917666000 1:177226465-177226487 GAGCATGAAGAACCCCAACTAGG + Intronic
919105742 1:193148310-193148332 TGCCAAAAAGAACCCCAAACTGG - Intronic
922565603 1:226599614-226599636 TATCATGAAAAACTCCTAAGAGG + Intronic
923043630 1:230337884-230337906 TTCCATGAACATCACCAAAGGGG + Intronic
924665029 1:246062983-246063005 TAGCATAAAGAACGCAAAAGTGG - Intronic
1065392132 10:25193666-25193688 TACAATAAAGACACCCAAAGGGG - Intronic
1069246545 10:66214164-66214186 TACCCTGAAGACAGCCAAAGAGG - Intronic
1070439507 10:76429652-76429674 TACAATGAACATCCCCAAATGGG + Intronic
1070899181 10:80013161-80013183 TACCATTTTGAAGCCCAAAGGGG - Intergenic
1071918106 10:90318987-90319009 TTCCTTGTAGAACCCCTAAGTGG - Intergenic
1071965492 10:90847715-90847737 AACCATGAACAACCCAAAGGTGG + Intronic
1075530965 10:123229440-123229462 TAACATAAAGATACCCAAAGGGG - Intergenic
1078298390 11:10099903-10099925 TACAATGAAAAACACAAAAGAGG + Intronic
1079282975 11:19104556-19104578 GAGCATGCAGAACCCTAAAGGGG + Intergenic
1080093953 11:28382402-28382424 TCCCATGAAAAAACCCAAAATGG + Intergenic
1080396398 11:31894042-31894064 TACAAGGATGAACTCCAAAGAGG + Intronic
1081103891 11:39040343-39040365 TAACATGAAGAAGTCCAAGGAGG + Intergenic
1084085293 11:66852321-66852343 TGACACGAAGAACACCAAAGAGG - Intronic
1088023519 11:105150013-105150035 TACCATGAAGAACACATATGTGG + Intergenic
1088285298 11:108181613-108181635 TACCATTTTGAAGCCCAAAGGGG - Intronic
1089818271 11:121197027-121197049 TTCCAGGTAGATCCCCAAAGAGG + Intergenic
1095905424 12:47372315-47372337 CACAATGATGAAGCCCAAAGAGG - Intergenic
1098964751 12:76775113-76775135 TATCAGGAATAACCACAAAGAGG - Intronic
1101672775 12:106892228-106892250 TACCCTGCAGAACCCCAGAATGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102346106 12:112162391-112162413 TACCGTGAAGACCCCCTCAGTGG - Exonic
1102810925 12:115823653-115823675 TTCCAGGAAGAACAGCAAAGAGG - Intergenic
1103012588 12:117468577-117468599 TCCCATGAAGTTCCCCAAGGCGG - Intronic
1106208941 13:27623022-27623044 GATCATGAAGAACCCGGAAGTGG + Exonic
1106898526 13:34331044-34331066 TTCCATGAAGGACCACAAAAAGG + Intergenic
1107156510 13:37173339-37173361 TAGCATTAAGAACCCAAACGAGG - Intergenic
1108211495 13:48144051-48144073 TACCATGAAGAAAAGCACAGAGG + Intergenic
1110751088 13:79117336-79117358 TACCATGAAGAACAGCATAAAGG - Intergenic
1115662679 14:35512433-35512455 CTTCATGAAGAACCACAAAGAGG - Intergenic
1115901737 14:38158559-38158581 TACCATAAAGAATTCCAAACTGG - Intergenic
1116163163 14:41296217-41296239 TACCACGAAGAACCCCACAGGGG - Intergenic
1116575000 14:46562951-46562973 TACTTTTAAGAACCCCAAACTGG + Intergenic
1117649488 14:57888050-57888072 TACAATGAAGAACTCCATGGGGG - Intronic
1120455164 14:84720214-84720236 CACCATGAAGAATCCGAATGCGG + Intergenic
1123204427 14:106698746-106698768 TACAAAGAAGAACCCAAAAAGGG + Intergenic
1123209433 14:106745217-106745239 TACAAAGAAGAACCCAAAAAGGG + Intergenic
1126675735 15:51158057-51158079 TGCCATGAGGAAGCCCAAAGAGG - Intergenic
1128712526 15:69882949-69882971 AACCATGAAGACCACCATAGGGG - Intergenic
1128991043 15:72260567-72260589 TACCATGAAGAACCCCAAAGTGG - Exonic
1138144832 16:54599155-54599177 GACAATGAAGACCACCAAAGGGG - Intergenic
1139007239 16:62587627-62587649 TACCATAAAGAGCCCAAAACTGG - Intergenic
1139334148 16:66219176-66219198 TAAGATGAAGAAACTCAAAGAGG + Intergenic
1140652539 16:77104697-77104719 GACCTTGAAAATCCCCAAAGAGG + Intergenic
1140854945 16:78969774-78969796 TTACATGAAATACCCCAAAGAGG + Intronic
1143307056 17:5955783-5955805 TACCATGAGGAACCCCAAGCAGG + Intronic
1146110060 17:30081266-30081288 GACCATTAAGACCCACAAAGCGG + Intronic
1149284655 17:55149077-55149099 TACAATGAAGAAACCAACAGAGG + Intronic
1152307662 17:79530711-79530733 AACCATGAAGAAGCCCAGACGGG + Intergenic
1155830627 18:30511980-30512002 TACCTTTAAAAAACCCAAAGAGG + Intergenic
1156123495 18:33874478-33874500 TACAGTGAAGATCCCCTAAGAGG + Intronic
1156686142 18:39649167-39649189 TACAATGAAGAACCTTTAAGGGG + Intergenic
1156994157 18:43446875-43446897 TTCCTTGATGAACCCCAATGTGG - Intergenic
1158661307 18:59390716-59390738 TAAAATGAAGAACCACAAACTGG - Intergenic
1159755842 18:72363328-72363350 TTCCATAATGAGCCCCAAAGAGG + Intergenic
1162581287 19:11532225-11532247 TACCAGGAAGAATACCAGAGAGG - Intergenic
1163986984 19:20962714-20962736 TATGAAGAAGAACCACAAAGAGG + Intergenic
1167387480 19:49172236-49172258 CACCATGCAAAGCCCCAAAGGGG - Intronic
1167801641 19:51746746-51746768 GACCATGAAGAATGGCAAAGTGG + Exonic
1167840202 19:52110519-52110541 TATCATGAAGAAAGCCAATGTGG + Intergenic
927460324 2:23293086-23293108 CACCCTGATGAACCCCAGAGAGG + Intergenic
927468560 2:23355118-23355140 TGCAATGAGGAACCTCAAAGTGG + Intergenic
928435102 2:31249738-31249760 TAGCATGAATAAACCCAACGAGG - Intronic
931151283 2:59576417-59576439 AACCATGTAGAACCCAGAAGAGG + Intergenic
933628921 2:84634614-84634636 TACCATTAGGAACGCCAAAGCGG + Exonic
936708525 2:115103705-115103727 TTCCATGAAGAATCAGAAAGGGG + Intronic
941511805 2:166419767-166419789 TATCATGAAGATCCACAAGGTGG - Intronic
943548658 2:189311883-189311905 TATAAAGAAGAACCACAAAGAGG - Intergenic
943935862 2:193916350-193916372 TACCTTGAAGAATAGCAAAGAGG - Intergenic
947057209 2:226118721-226118743 TACCATAAAGTACCCCTAAGAGG - Intergenic
948690375 2:239698421-239698443 AACCATCAAGGACCCCAAACAGG + Intergenic
1168972704 20:1941675-1941697 CACCAGGAGGAACCCCAAGGAGG - Intergenic
1169201638 20:3713026-3713048 TACTCTTAAGAACCCCCAAGAGG + Intergenic
1170329108 20:15189025-15189047 GACCATGCTGAACCCTAAAGGGG - Intronic
1171120749 20:22567464-22567486 CACCATAAAGACCCCCAAAAGGG - Intergenic
1172667356 20:36609711-36609733 TACCATGAACAAGGCAAAAGAGG - Exonic
1176027068 20:62991224-62991246 TACCGTGAAGTACCACAAACTGG + Intergenic
1179320204 21:40284237-40284259 TACAAAGAAGAATCCCGAAGTGG + Intronic
1179530254 21:42013432-42013454 TACACTGAAGCACCCCAAACAGG + Intergenic
950749071 3:15114603-15114625 CAGCATGAAGACCCCCACAGAGG + Intergenic
951737210 3:25881056-25881078 TACCAAGAAGACCCCCAAGGGGG - Intergenic
954188417 3:48938474-48938496 CCACATGAAGAAACCCAAAGGGG + Intronic
963089651 3:141471260-141471282 TATGAAGAAGAACCACAAAGAGG - Intergenic
966102177 3:176283965-176283987 TACACTGAAGAGCCCCAAATTGG + Intergenic
966226353 3:177602332-177602354 GACGATGAAGAAAACCAAAGAGG - Intergenic
970466241 4:16325905-16325927 TACCCTGGAGAACCCCACAAAGG + Intergenic
970793420 4:19887319-19887341 TACCCTGAAGATCCAGAAAGAGG + Intergenic
971135811 4:23867171-23867193 TACCATGAAGACACACATAGAGG - Intronic
971366569 4:25982353-25982375 TCCCATGAAGATCCCAACAGAGG + Intergenic
974387595 4:61222831-61222853 TACAATTAAGGACCCCTAAGAGG - Intronic
978361913 4:107939655-107939677 TACCATGCAGAATCTCAAAACGG + Intronic
979974103 4:127174561-127174583 TACTATGAAGAATGTCAAAGGGG - Intergenic
990605763 5:57408249-57408271 CACCATTATGAACCCCAGAGTGG - Intergenic
993671894 5:90770412-90770434 TAACAAGAAGTACCACAAAGTGG - Intronic
994206064 5:97036883-97036905 TACCATGACTAACTCCAAAAAGG - Exonic
997021700 5:130009870-130009892 CACCATCAAGAAGCACAAAGAGG + Intronic
1000446581 5:161329962-161329984 TACCATCAAAAACCTTAAAGTGG + Intronic
1003302725 6:4898984-4899006 TACTTTGAAGAAATCCAAAGTGG - Intronic
1008972221 6:57382420-57382442 GACCATGAAGAAACCCACAGAGG - Intronic
1009161135 6:60283957-60283979 GACCATGAAGAAACCCACAGAGG - Intergenic
1011239868 6:85259505-85259527 AACCATGAAAAACACAAAAGGGG + Intergenic
1011501426 6:87994512-87994534 TAAAATGAAGCTCCCCAAAGAGG - Intergenic
1014544782 6:122721181-122721203 TACCATAACTAACCCCAAACAGG + Intronic
1015999694 6:139029643-139029665 TACCAGGCAGAACCCCAAGCTGG + Intronic
1021313586 7:19118787-19118809 TAAAACGAAGAGCCCCAAAGAGG + Intergenic
1023106999 7:36772295-36772317 TGCCAAGAAGAGCCCCATAGTGG - Intergenic
1025294031 7:57761457-57761479 GACCATGAAGATGGCCAAAGAGG + Intergenic
1030734892 7:113036325-113036347 TTCCATAAAGAAGCCCTAAGAGG - Intergenic
1037165042 8:15817243-15817265 TACCATGAAGAACCTAAATATGG - Intergenic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1038184929 8:25264455-25264477 TAGCAAGAGGAACACCAAAGGGG - Intronic
1038905296 8:31895430-31895452 TACCATCAACAAAGCCAAAGGGG - Intronic
1039494340 8:37969393-37969415 GCCCATGAAGAACCCCAAGCAGG + Intergenic
1042583521 8:70309093-70309115 TACTATGAAGAAGCCCAAGCTGG + Intronic
1044501217 8:92960533-92960555 TTCAATGAAGAACCTCAAAATGG + Intronic
1047850121 8:128848107-128848129 AACCAGGTAGAACCCCACAGAGG - Intergenic
1047865919 8:129024096-129024118 TACCCTGTAGAACCACAAGGTGG + Intergenic
1048058643 8:130894261-130894283 TAGCAGGCACAACCCCAAAGAGG - Intronic
1050452589 9:5798830-5798852 TACCAAGGAAAACCACAAAGAGG + Exonic
1056731543 9:89170173-89170195 TACCATGTCGAATCCCAAACAGG - Intronic
1059467389 9:114477636-114477658 TCCCCTGAAGATTCCCAAAGAGG - Intronic
1185987329 X:4849898-4849920 GACCTTGAAGTACCCCACAGGGG + Intergenic
1187047377 X:15660506-15660528 TACCATAAAGAACAGAAAAGGGG + Intronic
1190783234 X:53619252-53619274 TACCAATAGGAACCCCAAAAAGG - Intronic
1193531697 X:82662237-82662259 TACCATAAAGGGACCCAAAGTGG + Intergenic
1196030276 X:111089381-111089403 TTCCATGAATAACCCAAAATTGG + Intronic
1196154370 X:112411150-112411172 AACCATGAAGAAATCCAAAATGG + Intergenic
1199072113 X:143489372-143489394 TACCATGATCATTCCCAAAGTGG + Intergenic
1199419341 X:147626030-147626052 TACCAAGAAAAAAGCCAAAGAGG + Intergenic
1200915081 Y:8564458-8564480 GACCATGGAGACACCCAAAGTGG + Intergenic