ID: 1128991932

View in Genome Browser
Species Human (GRCh38)
Location 15:72267977-72267999
Sequence CCGGTAGGTCACCTGAAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63582
Summary {0: 1, 1: 5, 2: 222, 3: 5584, 4: 57770}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128991932_1128991938 -1 Left 1128991932 15:72267977-72267999 CCCGACTTCAGGTGACCTACCGG 0: 1
1: 5
2: 222
3: 5584
4: 57770
Right 1128991938 15:72267999-72268021 GCCTCGGCCTCCCAAATTGCTGG 0: 748
1: 88189
2: 224764
3: 322686
4: 346792
1128991932_1128991940 0 Left 1128991932 15:72267977-72267999 CCCGACTTCAGGTGACCTACCGG 0: 1
1: 5
2: 222
3: 5584
4: 57770
Right 1128991940 15:72268000-72268022 CCTCGGCCTCCCAAATTGCTGGG 0: 1115
1: 130706
2: 290729
3: 319061
4: 327272
1128991932_1128991942 8 Left 1128991932 15:72267977-72267999 CCCGACTTCAGGTGACCTACCGG 0: 1
1: 5
2: 222
3: 5584
4: 57770
Right 1128991942 15:72268008-72268030 TCCCAAATTGCTGGGAATACAGG 0: 38
1: 5050
2: 317208
3: 368745
4: 357413
1128991932_1128991945 27 Left 1128991932 15:72267977-72267999 CCCGACTTCAGGTGACCTACCGG 0: 1
1: 5
2: 222
3: 5584
4: 57770
Right 1128991945 15:72268027-72268049 CAGGCGTGAGCCATTGCACCTGG 0: 219
1: 8183
2: 41139
3: 98596
4: 129873

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128991932 Original CRISPR CCGGTAGGTCACCTGAAGTC GGG (reversed) Intronic
Too many off-targets to display for this crispr