ID: 1128992308

View in Genome Browser
Species Human (GRCh38)
Location 15:72271460-72271482
Sequence AGTTGGAAAAGGAAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 8, 3: 50, 4: 457}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128992299_1128992308 19 Left 1128992299 15:72271418-72271440 CCTTTCCTCTGGAGAGATGGAAA 0: 1
1: 0
2: 2
3: 45
4: 308
Right 1128992308 15:72271460-72271482 AGTTGGAAAAGGAAGGTGGTGGG 0: 1
1: 0
2: 8
3: 50
4: 457
1128992301_1128992308 14 Left 1128992301 15:72271423-72271445 CCTCTGGAGAGATGGAAAGTGGA 0: 1
1: 0
2: 0
3: 30
4: 284
Right 1128992308 15:72271460-72271482 AGTTGGAAAAGGAAGGTGGTGGG 0: 1
1: 0
2: 8
3: 50
4: 457
1128992298_1128992308 20 Left 1128992298 15:72271417-72271439 CCCTTTCCTCTGGAGAGATGGAA 0: 1
1: 0
2: 1
3: 36
4: 323
Right 1128992308 15:72271460-72271482 AGTTGGAAAAGGAAGGTGGTGGG 0: 1
1: 0
2: 8
3: 50
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128992308 Original CRISPR AGTTGGAAAAGGAAGGTGGT GGG Intronic
900456774 1:2778706-2778728 AATTGGAAAAAGAAGAGGGTGGG - Intronic
901845806 1:11981206-11981228 AGTTAAAAAAGGAAGGAGGCCGG + Intronic
902573371 1:17361100-17361122 AGTTTGAAAACCACGGTGGTAGG - Intronic
904495884 1:30886380-30886402 ATTTGGACCAGGGAGGTGGTTGG - Intronic
904776128 1:32907998-32908020 AGGTGGAAAGGTAAGGTAGTTGG - Intergenic
905307227 1:37028157-37028179 ACCTGGAAAGAGAAGGTGGTTGG - Intronic
906054341 1:42903166-42903188 AGTTTGAAGGGGAAGGTGGGAGG - Intergenic
906468706 1:46108759-46108781 TGATGGAACAGGAAGGTGGTGGG - Intronic
906726526 1:48048455-48048477 CCTGGGAAAAGGAAGGTGGCTGG + Intergenic
907457122 1:54582976-54582998 AGTGGGTAGAGGGAGGTGGTAGG - Intronic
908661767 1:66444931-66444953 GGAGGGAATAGGAAGGTGGTGGG - Intergenic
909062348 1:70893519-70893541 AGTTGGATAAGGCAGATGCTGGG - Intronic
909459456 1:75893422-75893444 AGTTGGAATAGGAATGTGTAGGG + Intronic
909489461 1:76209971-76209993 AGTTGGAAAATGAAACTGGCTGG - Intronic
909717026 1:78721518-78721540 ACTTGGCAAAGGAAGGAGTTTGG - Intergenic
909840121 1:80310407-80310429 AGTTTGAAAAGGAAAGTAGAGGG - Intergenic
910468707 1:87527998-87528020 AGTTTAAAAAGCAATGTGGTTGG + Intergenic
911342067 1:96651526-96651548 AGTTGGAAAAGCACGGTATTTGG - Intergenic
911606555 1:99912127-99912149 AGTTGGAAAAGGTAGGAGTAAGG - Intronic
912338323 1:108884617-108884639 AGAGGGAAAAGGAAGGAGATGGG + Intronic
913359142 1:117960187-117960209 ACTTGAAAAATGCAGGTGGTAGG + Exonic
913483744 1:119315139-119315161 ATTTGGGCAAGGATGGTGGTTGG + Intergenic
913488689 1:119357782-119357804 AGTTGGAGAAGGATGGGGATTGG + Intergenic
914756295 1:150563249-150563271 AGATGGACATGGAGGGTGGTGGG + Intergenic
914829945 1:151163826-151163848 AGTTGGAAAGGGGCTGTGGTGGG - Intronic
915030038 1:152871223-152871245 AGTTGGAAGAGGCAGGTAGTGGG - Intergenic
915315210 1:155024671-155024693 AGAAGGAAAAGGTAGGTAGTGGG - Intronic
915479537 1:156175488-156175510 AGTGGGAAGAGGAAGGAGGAAGG - Intronic
915954791 1:160212758-160212780 AAGTGGAAAAGGATGGGGGTGGG + Intronic
916050491 1:161033087-161033109 AGTATGAAAAGGAAGGTGTAAGG + Intronic
916146409 1:161744094-161744116 AGCAGGAAAATGGAGGTGGTAGG - Intergenic
916214362 1:162383102-162383124 AGTTGGAGAAGCAAGATGGCAGG + Intronic
916243608 1:162664035-162664057 AGTGAGAAAAGGAAGGGGGCTGG + Intronic
916571333 1:166030428-166030450 AATTAAAAAAGGAAGGTGCTTGG + Intergenic
916620197 1:166488785-166488807 AGTTGGAAGAGGATGGGGCTGGG - Intergenic
916949351 1:169763184-169763206 AGTTGGAAAGAAAAGATGGTTGG + Intronic
917636864 1:176945507-176945529 AGTTGGAAAAGGCAGGACCTTGG + Intronic
918151131 1:181798924-181798946 AGAGGGAAAAGGAAGATGGAAGG + Exonic
919501095 1:198339241-198339263 AGTTGGATAAAGAAGGCAGTTGG - Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922208168 1:223467077-223467099 AGCTGGAGAAGGCTGGTGGTAGG - Intergenic
922464844 1:225839658-225839680 AGTTGGAGAAGGGAGGTTGGGGG - Intronic
1062781123 10:208773-208795 AGGTGGAGAAGGAAGAAGGTGGG + Intronic
1063777721 10:9283297-9283319 AGGTTGAAAAGGAAAGTGGCAGG - Intergenic
1064148249 10:12842214-12842236 TGATGCAAAAGGAAGGGGGTGGG + Intergenic
1064639006 10:17396685-17396707 AGCTGGGAAAGGACTGTGGTAGG - Intronic
1065802965 10:29369174-29369196 AATTAGAAATGGAAAGTGGTAGG - Intergenic
1066254737 10:33667427-33667449 AGTTGGAAAAGAGAGGGTGTGGG + Intergenic
1066559036 10:36648022-36648044 AGTAGGATAAGGTAGGTGATGGG + Intergenic
1067251522 10:44590670-44590692 AGTCGGAAAGGGAAGGTGGAAGG - Intergenic
1067705582 10:48604544-48604566 AGTTGCAAAAGGGCGGTGGCCGG - Intronic
1067773968 10:49148265-49148287 AGTTAGGTAAAGAAGGTGGTTGG - Intergenic
1067783468 10:49226012-49226034 AGCTGCAAAAGAAAGTTGGTGGG + Intergenic
1068528768 10:58161773-58161795 ATTTGTAAAATGAAGGGGGTGGG - Intergenic
1068579126 10:58719346-58719368 AGTTGGAAAAGGGAGGATGGAGG - Intronic
1068937312 10:62648583-62648605 AGTTGGGAAAAGAATGAGGTTGG + Intronic
1069507454 10:69013462-69013484 AGCTGGAAAAGGAGGGTTGCAGG + Intronic
1069604296 10:69730147-69730169 AATTGGAACAGTAAGGGGGTTGG - Intergenic
1069721092 10:70549793-70549815 CATTGGAGAAGGAAGGTGGCTGG + Intronic
1070266165 10:74905400-74905422 TGATGGAAAAGGTAGGCGGTAGG + Intronic
1070488621 10:76954669-76954691 AGTTGGGAGGTGAAGGTGGTGGG - Intronic
1072236196 10:93455726-93455748 AGTTGGGAGAGAAAGGTGGGTGG + Intronic
1072457315 10:95588101-95588123 AGTTGGAAAAGTAAGGTGTGAGG + Intergenic
1072830094 10:98648291-98648313 AGCTGGGAAAGGAAAGAGGTAGG + Intronic
1072957226 10:99897982-99898004 AGTTGGACAAGGCAGGTGGTAGG - Intronic
1073173548 10:101534526-101534548 AGTGGGAGAAGGAAGGGGATGGG - Intronic
1073206871 10:101774313-101774335 AGTTGGAAAAGGAGGTTGCTGGG - Intronic
1073524048 10:104162800-104162822 AGTTGGGCAAGAAAGGGGGTGGG + Intronic
1073605102 10:104886850-104886872 AGTTGGACCAAGAAGGTAGTGGG - Intronic
1073960436 10:108920794-108920816 AGTTAGAACAGCAAGGTGGTGGG - Intergenic
1074154718 10:110788065-110788087 AGCTGGTAAATGGAGGTGGTGGG + Intronic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1075244702 10:120810758-120810780 AGTTGGAAGAGCAAGGATGTTGG - Intergenic
1075416166 10:122265945-122265967 AGCTTGATAAGGGAGGTGGTTGG + Intergenic
1076171277 10:128322243-128322265 CGTGGGAACAGGAAGGTGGAAGG + Intergenic
1076190177 10:128477360-128477382 GGGAGGAAAAGAAAGGTGGTAGG + Intergenic
1076444235 10:130500855-130500877 ATTTGGAAATGGAAGATGGAAGG + Intergenic
1077838502 11:5946480-5946502 AGATGGAAAAGGAAACTGGAAGG + Intergenic
1077885558 11:6385054-6385076 AGTAGGAAAAGGAGGGAGGAGGG - Intergenic
1079408031 11:20162484-20162506 AGTGGGAGAAGGAGGGAGGTGGG - Intergenic
1079987772 11:27216412-27216434 AGCTGGACAAGGAAGGGGGTGGG + Intergenic
1080050808 11:27857133-27857155 AGCTGGAAAAGGAAGGAAGGTGG - Intergenic
1080250491 11:30228316-30228338 GGTGGGTAGAGGAAGGTGGTAGG - Intergenic
1080320053 11:30997990-30998012 AGTTTAAAAAGAAAGGGGGTGGG + Intronic
1080543620 11:33294430-33294452 TGTAGGAAAAGGTAGGTGGGTGG - Intronic
1080727073 11:34909076-34909098 AGTTTAAAAAGGAAGCTGGAAGG + Intronic
1081423509 11:42899965-42899987 AGATGGAAAGGGAAGGTGGTTGG - Intergenic
1081743051 11:45454301-45454323 AGCAAGAAAAGGAAGGAGGTGGG - Intergenic
1081829613 11:46097083-46097105 ACTTGGACCAGGGAGGTGGTAGG - Intronic
1082811180 11:57479943-57479965 AGCTGGAGCAGGGAGGTGGTGGG - Intergenic
1083965609 11:66042171-66042193 ACTTGGAAAAGACAGGTTGTGGG + Exonic
1084038949 11:66530609-66530631 AGGTGGAACAGGCAGGGGGTGGG + Intronic
1084675469 11:70631422-70631444 ATTTGGAGAAGGCAGGTGGGAGG - Intronic
1084677928 11:70647391-70647413 AGGTGGCACAGGAGGGTGGTTGG + Intronic
1085395461 11:76205017-76205039 CATTGCAAAAGGAAGGTGGCTGG + Intronic
1086369385 11:86141337-86141359 AGTTGGAAATGGGAAGTGGGTGG - Intergenic
1087279502 11:96194382-96194404 ATTTGGAAAAGGAAGTAGCTAGG + Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088256669 11:107909722-107909744 AGGTGGATAAGGAAGGAGGTGGG - Intronic
1088536600 11:110868208-110868230 AGATGGAAGAGTGAGGTGGTTGG - Intergenic
1088847802 11:113682435-113682457 AGTTGGAGGAGGAAGGTCCTGGG - Intergenic
1089126669 11:116181130-116181152 AGAGGCAAAAGGAAGGGGGTGGG + Intergenic
1090643617 11:128749749-128749771 AGTTGGATAAGGAAGAAGGTGGG - Intronic
1092132853 12:6124632-6124654 GGTGGGAAAGGGAGGGTGGTTGG - Exonic
1092936949 12:13372945-13372967 ATTTGGAAAAGCAAGGTGTTTGG + Exonic
1093591091 12:20903702-20903724 AATTGGAGAAGGAACCTGGTGGG - Intronic
1093674910 12:21927329-21927351 ATGTGGATAAGGAAGTTGGTTGG + Intronic
1094462660 12:30714120-30714142 GGTTGGGAAAGGGTGGTGGTAGG + Intronic
1095991733 12:48039405-48039427 AGTTACAAAGGGAAGGGGGTGGG - Intergenic
1096152840 12:49325463-49325485 AGAAGGAAAAGGAAGGGGGAAGG - Intronic
1096183448 12:49563865-49563887 GCTTGGAAAGGGGAGGTGGTAGG - Intronic
1096787686 12:54027007-54027029 AGTTGACAAAGAAGGGTGGTGGG - Intronic
1096859611 12:54515778-54515800 AATTCTAAAAGGAAGTTGGTGGG + Intronic
1096873340 12:54608590-54608612 AGCAGGAAAAGGAAGGGGCTGGG - Intergenic
1097693343 12:62754694-62754716 AGCTGGACAAGGAAGGGGTTTGG - Intronic
1097987694 12:65801735-65801757 AGTGGGATAAGGAAGCTGGAGGG + Intergenic
1098707790 12:73713322-73713344 AATGGGAAGAGGAAGGTGGTGGG - Intergenic
1100209837 12:92389270-92389292 AGTTGCTTGAGGAAGGTGGTAGG - Intergenic
1102238526 12:111309496-111309518 AGTTGGAGAATGGAGGGGGTAGG + Intronic
1102845041 12:116171567-116171589 CATTGCAAGAGGAAGGTGGTTGG - Intronic
1103098334 12:118150081-118150103 AACTGGAAAAGGAGGGAGGTGGG + Exonic
1103308196 12:119983038-119983060 AGTTGGGCAAGGATGTTGGTAGG + Intergenic
1103346609 12:120255262-120255284 ACTTGGGAAAAGAAGGTGGGAGG + Intronic
1104508852 12:129357465-129357487 AGTAGAAAAAGGAAGGAGGAAGG + Intronic
1104850246 12:131869449-131869471 ACTTGGAAAAGGAAGGTCACCGG - Intergenic
1106156072 13:27157772-27157794 AGTTGGAGAAGGAAGGCTTTTGG - Intronic
1106156931 13:27168112-27168134 AGCTGGTAAAGGTAGGTGCTAGG - Intronic
1106224948 13:27778232-27778254 AGTGGGAAAAAGAAGGTGGTGGG + Intergenic
1106328765 13:28719268-28719290 AGTTGGAAAAGTAACATGTTTGG + Intergenic
1106487580 13:30185840-30185862 AGTTGCAAGAGGAAGGAGCTGGG + Intergenic
1107969924 13:45631571-45631593 AGTTGGAAATGGAAGGAAGGTGG - Intergenic
1108137174 13:47378178-47378200 AGTTGGAAAGGTAAGCAGGTTGG - Intergenic
1108478319 13:50843036-50843058 AGTGGGAGAAGGAAGGGGGCGGG - Intronic
1108913885 13:55585240-55585262 AGTTGAGAAAGGAAGGAGGGAGG + Intergenic
1109130059 13:58574095-58574117 AATTGGAAGAGGAACCTGGTGGG - Intergenic
1109992564 13:70078236-70078258 TGTTGTAATAAGAAGGTGGTTGG - Intronic
1110645421 13:77877739-77877761 AGCTGGACAAGGGACGTGGTTGG + Intergenic
1112927422 13:104693755-104693777 AGGTGGAAAAGGAAGGCAGAAGG + Intergenic
1114191940 14:20446162-20446184 AGTTGGAAAAGGTAGGTAGATGG + Intergenic
1114481186 14:23035818-23035840 ATTTGAAAAATGAAGGTGGGTGG - Intergenic
1114519824 14:23326051-23326073 AGTGGGAACAGGGAGGTGGGAGG + Exonic
1114667036 14:24384183-24384205 AGTTGGAGAACGAAAGTGGCAGG + Intergenic
1115820999 14:37212188-37212210 AGTTGGAAAAGTAAAGAGGATGG + Intronic
1116625452 14:47256985-47257007 AGATGAAAAAGGAAGGGGATAGG + Intronic
1116820157 14:49620195-49620217 AGCTGGAAAATGGAGGAGGTGGG - Intronic
1117177170 14:53156625-53156647 AATGGGGACAGGAAGGTGGTAGG - Intergenic
1117246298 14:53889877-53889899 TGGTGGGAAAGGGAGGTGGTGGG + Intergenic
1117786357 14:59289974-59289996 ACTTGAACAGGGAAGGTGGTGGG + Intronic
1118569640 14:67180617-67180639 AGTTTGAATGAGAAGGTGGTAGG + Intronic
1118748294 14:68789708-68789730 GGCCGGAAGAGGAAGGTGGTCGG + Exonic
1119545186 14:75466845-75466867 ATTTGGAGAAGGAAGGAGATAGG - Intronic
1120195544 14:81478360-81478382 AGTTGGAATAACTAGGTGGTAGG + Intronic
1120324304 14:83005893-83005915 AGGTGAGAAAGCAAGGTGGTTGG + Intergenic
1120848860 14:89150519-89150541 AGTGATAAAAGTAAGGTGGTGGG + Intronic
1121010271 14:90516206-90516228 AGTTAGAAAAGCAAGTTGGCTGG + Intergenic
1202933564 14_KI270725v1_random:62605-62627 AGTGAGGAAAGGAAGGTGTTAGG - Intergenic
1123788670 15:23697541-23697563 AGTTGCAAAAGCAAAGTGGGGGG - Intergenic
1124184893 15:27516128-27516150 TATTGAAAAAGGAAGTTGGTAGG - Intronic
1124598329 15:31110003-31110025 ACTTTGAAAAGGAAGGTTTTTGG - Intronic
1125358719 15:38843605-38843627 GTTTGGAAAAGGATGGTAGTGGG + Intergenic
1126019137 15:44382706-44382728 ATTTGGGTAAAGAAGGTGGTTGG + Intronic
1126077897 15:44931188-44931210 AGTGGGGAAAGGAGGGTGGTAGG + Intergenic
1126080640 15:44957779-44957801 AGTGAGGAAAGGAGGGTGGTAGG - Intronic
1127250866 15:57236235-57236257 AGTTGGAAAAAGAATGTATTTGG - Intronic
1127440409 15:59000960-59000982 AGCTGGAAAAGGAAGATAGAGGG + Intronic
1128187082 15:65651481-65651503 GGATGGAAAAGGATGGAGGTTGG - Intronic
1128725617 15:69986532-69986554 CCTAGGAAAAGGAGGGTGGTGGG + Intergenic
1128783357 15:70377414-70377436 GGTTGGAGGAGGAAGGTGGAGGG - Intergenic
1128992308 15:72271460-72271482 AGTTGGAAAAGGAAGGTGGTGGG + Intronic
1130925695 15:88384012-88384034 AGTTGAAGAAAGATGGTGGTGGG - Intergenic
1131310781 15:91288019-91288041 AGTTGGGAGGGGAAGGTGGCTGG - Intronic
1134113758 16:11532740-11532762 GGTTGGAAAAGTCAGGTGGATGG + Intergenic
1134849937 16:17471038-17471060 AGGAGGGAAAGGAAGGGGGTGGG + Intergenic
1135539628 16:23320185-23320207 ACTTGGAAGAGTAAGGTGGCGGG + Intronic
1136025416 16:27465290-27465312 CCTTGGAGAAGGCAGGTGGTGGG - Exonic
1136549894 16:30977403-30977425 AGTTCTCAGAGGAAGGTGGTGGG + Intronic
1137368540 16:47882723-47882745 AGTTGGAAAAATATGGGGGTGGG - Intergenic
1137928138 16:52561446-52561468 AGTGGCAAAAGGATGGTGGATGG - Intergenic
1138133554 16:54502124-54502146 AGTTGGAGAAGGTGGGTGGGGGG + Intergenic
1140108392 16:71982082-71982104 AGCTGGAGAAGGAAGTTGGCTGG - Exonic
1140276386 16:73512570-73512592 AGTTGGAAAAGGAGGCAGATGGG + Intergenic
1140851421 16:78938281-78938303 AGTTGGAAAAGGTAGGGTCTGGG - Intronic
1142105146 16:88298696-88298718 AGTGGGGAGAGGAAGGTGGGAGG - Intergenic
1142137526 16:88458474-88458496 AGTTGGAGAAGAAAGGAGGAGGG + Intronic
1142166650 16:88593955-88593977 AGTTGGAAAAGTGTGGTGATAGG + Intronic
1142364862 16:89644862-89644884 AAGTAGAAAAGGCAGGTGGTGGG - Exonic
1143694260 17:8599644-8599666 GGCTGTAAAAGGAAGGTGGAAGG + Intronic
1143794528 17:9326009-9326031 AGTGGGAAAAGGTTGGGGGTCGG + Intronic
1145872533 17:28286943-28286965 AATAGGAATAGGTAGGTGGTAGG - Intergenic
1146621602 17:34402667-34402689 AGCTGTAAAAGGATGGTGGGGGG + Intergenic
1146795196 17:35775442-35775464 AGTTCAAAAAGGAAGGGGGAAGG + Intronic
1146822683 17:35997219-35997241 AGTTGGAATAGGAAGTTAGAAGG + Intronic
1147448962 17:40491919-40491941 TGTTGGAAAATGAAAGTGGGGGG + Intronic
1147499043 17:40944602-40944624 AGCTGGAAAAGGAAGGAAGCTGG - Intergenic
1148398988 17:47337147-47337169 AGGAAGAAAAGGAAGGTCGTGGG + Intronic
1148398994 17:47337175-47337197 AGGAAGAAAAGGAAGGTCGTGGG + Intronic
1148826246 17:50396546-50396568 AGTGGGAAAAGGAGGGATGTGGG + Intronic
1148985094 17:51613668-51613690 AATAGGATAAGGAGGGTGGTGGG - Intergenic
1149387521 17:56156629-56156651 AGGTGGAAAAGGAAGGAGTAAGG + Intronic
1149530028 17:57387816-57387838 AGTGGGGAAGGGAAGGTGGTGGG + Intronic
1149914702 17:60598470-60598492 AGTTGGAATGGGAAGTTGATGGG + Intergenic
1150466120 17:65394106-65394128 AGAAGGTAGAGGAAGGTGGTGGG + Intergenic
1150647112 17:66985834-66985856 AGTGGGAAGAGGAAGGTCCTTGG + Intronic
1150884214 17:69066402-69066424 AGTTATAAAAGAAAGGTTGTAGG + Intergenic
1151343753 17:73488616-73488638 AGTGGTAGAAGGAAGGTTGTCGG - Intronic
1152368919 17:79873019-79873041 ATTAGGAAGAGGAAGGAGGTCGG - Intergenic
1154339473 18:13491255-13491277 AGATGGAAAAGGGAGGTCTTGGG - Intronic
1155366068 18:25050263-25050285 TGTGGGAAGAGGAGGGTGGTTGG + Intergenic
1155663342 18:28277991-28278013 AGTTGGAGAGGGATGGTGATGGG + Intergenic
1155969512 18:32068630-32068652 ACATGGAAAAGACAGGTGGTAGG + Exonic
1156810644 18:41245928-41245950 GGCTGGGAAAGGAAGGAGGTGGG - Intergenic
1159082619 18:63752699-63752721 AGTTGGAAAGGGAATGTGAAAGG + Intergenic
1159741303 18:72174442-72174464 AGTTGGAAAGAGAAGATGTTAGG - Intergenic
1161477686 19:4495568-4495590 AGAGGGAAAAGGAGGGCGGTGGG + Intronic
1162218810 19:9158777-9158799 TGTTGGAAAAGGAAAATGGTGGG - Intronic
1162891042 19:13733279-13733301 AGTTTGAACAGGAAGTTGGTGGG - Intronic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164458294 19:28426995-28427017 AGTTGGGGAAGGAAGGAGGTGGG + Intergenic
1164939911 19:32244254-32244276 AGCTGGAAAATGTAGGGGGTGGG - Intergenic
1165868272 19:38952431-38952453 AGTTAGAGCAAGAAGGTGGTAGG - Intronic
1166107414 19:40604164-40604186 AGTGCGGAAAGGAAGGTGGGAGG + Intronic
1166160226 19:40947218-40947240 AGGAGGAAAAGGAAGGCGGAGGG + Intergenic
1166169116 19:41014854-41014876 AGTAGGAAAAGGAAGGAGGAGGG + Intronic
1166388421 19:42395409-42395431 AGATTGAAAGGGAAGGTGGGAGG + Intergenic
926148190 2:10409654-10409676 GGGTGGAACAGGAAGGTGGAAGG - Intronic
926264627 2:11304268-11304290 AGTAGGAAAAGGAAGGGGTAGGG - Intronic
926780920 2:16471141-16471163 AGTTGTAGAAGGGAGGTGTTTGG + Intergenic
927151937 2:20201205-20201227 AAATGGCAAAGGAAGGTGGATGG - Exonic
927488379 2:23504627-23504649 AGCTGGAACTGGAAGGGGGTAGG + Intronic
928009886 2:27597331-27597353 AGCTGGAAAAGGGAGGTTCTAGG + Intronic
928427640 2:31192259-31192281 AGGTGGAAGAGCAAGGTGGGAGG - Intronic
928921839 2:36534715-36534737 AGAAGGAAAAGGAAGATGGAAGG + Intronic
929259285 2:39846731-39846753 AATTTGAAAACGAAGTTGGTTGG - Intergenic
930245670 2:48980822-48980844 AGTTGGATAATGAAGGAGTTGGG + Intronic
930368592 2:50475452-50475474 AGTGGGAAAAGGAAGTAAGTTGG - Intronic
931365815 2:61617889-61617911 AGTTAGAGAAAGAAGGTGGTTGG - Intergenic
932098492 2:68874087-68874109 GGGTGGACAAGGAAGGAGGTTGG + Intergenic
932202405 2:69842910-69842932 ATTTGAAAATGGAAGGTGGGGGG - Intronic
932495422 2:72143668-72143690 AGCTGGAAAAAGAAGGGGGCGGG - Intronic
932497815 2:72155374-72155396 AGTTGGGACAGGAATGGGGTGGG + Intergenic
932922288 2:75930110-75930132 AGTTGGCAAAGGAAGATAGTTGG + Intergenic
936061954 2:109300673-109300695 AGGAGGAAGAGGAAGGTGGTTGG - Intronic
936255205 2:110905090-110905112 AGCTGGAAAGGGAAGGTGCTGGG + Intronic
936780882 2:116030757-116030779 AGGGGGAAAAGGAAGGAGGGAGG - Intergenic
937781135 2:125838545-125838567 AAATGTAAAAGAAAGGTGGTGGG - Intergenic
937860355 2:126703398-126703420 AGATGAAGAGGGAAGGTGGTGGG - Intergenic
938613735 2:132975940-132975962 AGTTGTAAATGGTAGGTGGGTGG + Intronic
938736161 2:134188654-134188676 AACTGGAAAAAGGAGGTGGTGGG + Intronic
939111030 2:138007743-138007765 TTTTGGAGAAGGAAGGAGGTAGG - Intronic
939362888 2:141196760-141196782 GTTTGGAACAGGAAGATGGTAGG - Intronic
939894620 2:147776543-147776565 AGTTGGATAAGGAATGTTGGTGG + Intergenic
940875988 2:158897633-158897655 AGATGGAAAAAGGGGGTGGTTGG - Intergenic
941549346 2:166895442-166895464 AGGTGGATAAATAAGGTGGTAGG + Intronic
942537127 2:176976774-176976796 AGATGGACTAGGAAGGTGGCAGG + Intergenic
942844938 2:180412924-180412946 ACTTGGAAAAGGAATGAGGTGGG + Intergenic
943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG + Intergenic
943213047 2:184992858-184992880 ATCTGAAAAAGGAAGGTGGTAGG + Intergenic
943440737 2:187924622-187924644 AGTTTTAAAAGGAAGGGGCTTGG - Intergenic
943669901 2:190649210-190649232 AGGGGGGAAGGGAAGGTGGTGGG - Intronic
945495782 2:210505688-210505710 GGTTGGAAAAGCAAAGTGTTAGG - Intronic
945949094 2:216021824-216021846 AGTTGGCAATGGAAGGTGATGGG - Intronic
946155809 2:217806030-217806052 AGCTGGGAAAGGGAGGTGCTGGG - Intronic
946474734 2:219996318-219996340 AGGTGAAAAATGAAGGTGGTTGG - Intergenic
946712150 2:222517453-222517475 AGTTGGAAGGGGGATGTGGTGGG - Intronic
947079487 2:226380335-226380357 ATTTGGAAAAGGAAATTGATTGG - Intergenic
947295237 2:228623663-228623685 TGAGGGAACAGGAAGGTGGTGGG + Intergenic
948571156 2:238917811-238917833 AGTTTGAAAAGGAAAGAAGTGGG + Intergenic
948728745 2:239950377-239950399 CGTCTGAAAAAGAAGGTGGTGGG - Intronic
1170055763 20:12200908-12200930 AGCTGGAGAAGGAGGGTGGGTGG + Intergenic
1170784057 20:19452423-19452445 TGTTGGGGAAGTAAGGTGGTGGG + Intronic
1172313879 20:33938699-33938721 AGTGGGAGAAGGACTGTGGTAGG - Intergenic
1172758655 20:37306437-37306459 ACTATGAAAAGGAAGGGGGTGGG - Intronic
1172847930 20:37941066-37941088 AGTTGGAGAAAGAAGGTCATGGG + Intronic
1175006054 20:55684699-55684721 AGTTAGAAAAGGAAGCGGTTGGG - Intergenic
1175305777 20:57974572-57974594 TGTGGGAAAAGGCAGGGGGTGGG - Intergenic
1176594963 21:8684763-8684785 AGTGAGGAAAGGAAGGTGTTAGG - Intergenic
1177599099 21:23288001-23288023 TGTTGGAAGAGGAACCTGGTGGG + Intergenic
1177736581 21:25098150-25098172 ATTTGGGGAAGGAATGTGGTTGG - Intergenic
1180058653 21:45373801-45373823 AGTTTGAAAAGGATGATGGCAGG - Intergenic
1182063106 22:27411872-27411894 ACTTGGAAAATGGAGGTGGGAGG + Intergenic
1183445042 22:37848037-37848059 AGTGGGAAAAGCAAGGAGGGCGG + Intronic
1184553729 22:45220687-45220709 ACTTGGGAAAGTAAGGTGGGAGG - Intronic
950250823 3:11463888-11463910 AGTCTGTAAAGGAACGTGGTTGG + Intronic
950265549 3:11570312-11570334 AGTTGGGGCAGGAAGGTGGGTGG - Intronic
950954347 3:17035558-17035580 AGTGGGAACAGGAAGCAGGTGGG - Intronic
951353058 3:21630184-21630206 AGAAAGAAAAGAAAGGTGGTAGG - Intronic
951353105 3:21630508-21630530 ATTTTGAAAATAAAGGTGGTAGG - Intronic
951440482 3:22717520-22717542 AGTTTAAAAATGAAGGTAGTTGG + Intergenic
951778741 3:26339859-26339881 TGTTGGAAGAGGAGGCTGGTGGG - Intergenic
951811515 3:26705798-26705820 TGTTGGAAAAGGAAGGTATGAGG - Intronic
952097756 3:29974249-29974271 AGGTGAAAATGAAAGGTGGTGGG - Intronic
953064356 3:39455732-39455754 AGATGGAGATGGAGGGTGGTTGG + Intergenic
953764092 3:45721076-45721098 AGTTTGAAAAGCAAAGTGTTTGG - Intronic
953971488 3:47351986-47352008 AGTTAGAAAAAGGTGGTGGTGGG - Intergenic
954268402 3:49488238-49488260 AGATGGAAGAGGAAGGAGGTGGG - Intronic
955065911 3:55533592-55533614 AGGTGAGAAAGGAAGGTGATGGG + Intronic
955473646 3:59313200-59313222 AGGTGGAAAATGGAGTTGGTGGG + Intergenic
955612360 3:60771097-60771119 AGTTGGAAAAGGAATGCAGGTGG - Intronic
955726146 3:61935002-61935024 AGCTGTGAAAGGAAGGTGGAAGG - Intronic
957298246 3:78359368-78359390 AATTGGTAATGGAAGATGGTAGG - Intergenic
957321370 3:78635095-78635117 AGTTGGAAAAGATAGGTGTTTGG - Intronic
957550947 3:81703733-81703755 ATTTGGAAAAGAAAAGTGGATGG + Intronic
957638801 3:82821779-82821801 AGTTGGGAAATTAAGGAGGTGGG - Intergenic
958662988 3:97095491-97095513 ATTTTGAAAAGGAAGGTGGGGGG - Intronic
959706626 3:109344039-109344061 AGTTGGAAAGCTAAGGTGGGAGG - Intergenic
960335611 3:116414006-116414028 AGGTGGAAAAGGAAGGAGGCAGG + Intronic
961045842 3:123707436-123707458 AGTTGGAAAAGCAGGGGGATAGG - Intronic
961728012 3:128945509-128945531 AGCAGGAGAAGGAAGGTTGTGGG - Exonic
963524671 3:146403063-146403085 AATTGGAAAAGGATGGGGATAGG - Intronic
964352285 3:155815072-155815094 ATATGGAAAGGGAAGGTGGTTGG + Intergenic
964549823 3:157873915-157873937 AGTGGGAAAAGGAAGCCTGTGGG - Intergenic
965228103 3:166017829-166017851 TCTTGGAGAAGTAAGGTGGTTGG + Intergenic
965722160 3:171673889-171673911 AGTTGGTAAAGGAAGCAGATTGG + Intronic
966604489 3:181808834-181808856 AGTCAGTAAAGAAAGGTGGTTGG - Intergenic
966942190 3:184754287-184754309 TGGTGGAAGAAGAAGGTGGTGGG + Intergenic
967930053 3:194684635-194684657 AGTTGGCAAAGGTAGAGGGTGGG + Intergenic
969384391 4:6834013-6834035 AGTTGGAAAGTGAAGAAGGTGGG - Intronic
969428141 4:7137867-7137889 TGCTGGAACAGGGAGGTGGTGGG + Intergenic
969680280 4:8639596-8639618 AGTTGGGAAAGGGAGGTAGGGGG + Intergenic
971339318 4:25753214-25753236 AGGAGGAAAATGAAGGTAGTTGG + Intronic
973317206 4:48774469-48774491 AATGGGAAAAGGAGGGTGGTAGG + Intronic
973598778 4:52520412-52520434 AGATGGCACAGGAGGGTGGTTGG - Intergenic
973844784 4:54900680-54900702 TGTGGGAAGAGGGAGGTGGTGGG + Intergenic
974145347 4:57940235-57940257 AGTTAGAAAAAGAAGGATGTTGG + Intergenic
974978132 4:68917544-68917566 AGTTGGAAAAGAGAGGAGATTGG - Intergenic
976582256 4:86751000-86751022 AGAGGGAAAAGGAAGGTAGGAGG - Intronic
976738276 4:88332801-88332823 AGAAAGAAAAGGAAGGAGGTAGG - Intergenic
977257166 4:94754199-94754221 GGGTGGAAAAGGAAAGTGGTAGG + Intergenic
977257374 4:94756314-94756336 AGGTGGAAAAGGGAAGGGGTGGG + Intergenic
977379923 4:96259421-96259443 ACTAGGAAAAAGAGGGTGGTTGG + Intergenic
977675051 4:99738210-99738232 GGTTAGAAAAGGAAGGAGGCAGG + Intergenic
977727678 4:100316159-100316181 AGTTGGAAACTGAAGGTAGGTGG - Intergenic
979049534 4:115911795-115911817 ACTTGGAAAAGTAATGGGGTGGG + Intergenic
979067642 4:116158221-116158243 AGTTTGTAAAAGCAGGTGGTAGG - Intergenic
980106911 4:128596529-128596551 GTTTGGAGAAGGAAGGTGATGGG - Intergenic
980788927 4:137593502-137593524 ATTTGGAAAAGAAAGGGGATAGG + Intergenic
981442314 4:144797224-144797246 TGTTGGAAATGGAACCTGGTGGG + Intergenic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981817786 4:148850886-148850908 TGTTGGAAAAGGAGGGAGATTGG + Intergenic
982295640 4:153826011-153826033 AGTTTGGAAAGCAAGGTGATAGG - Intergenic
982317583 4:154047161-154047183 AATTGGAGAAGGGATGTGGTGGG + Intergenic
982443943 4:155468536-155468558 TGTTGGCAAAGGAAGGTAGGAGG - Intergenic
982549748 4:156783136-156783158 AGTTGGAAAAAAATGGTGTTGGG + Intronic
983313548 4:166097261-166097283 AGTGGGAAAGGGAAGGTGCTTGG + Intronic
983902223 4:173147684-173147706 AGTTGGTAAAGGAAGATGGTGGG - Intergenic
984103306 4:175513924-175513946 AGGGAAAAAAGGAAGGTGGTGGG - Intergenic
984662569 4:182389253-182389275 AGGTGGAAAGGGCAGCTGGTGGG - Intronic
985409697 4:189670274-189670296 AGGTGGAGAAGGAAGGGGCTGGG - Intergenic
986811235 5:11361704-11361726 AGATAGAAAAAGATGGTGGTAGG - Intronic
988019715 5:25607553-25607575 AGTTACCAAAGGAAGCTGGTAGG + Intergenic
988194456 5:27984870-27984892 TGTTGGAAGAGGAAGGTGATTGG - Intergenic
988854738 5:35216942-35216964 AGGTGATAAATGAAGGTGGTAGG + Intronic
989141921 5:38209966-38209988 AGGGGGAAATGGAAGGTGGGAGG - Intergenic
989609680 5:43279002-43279024 ACTTGGAAAAGTAACTTGGTGGG + Intronic
990056154 5:51581231-51581253 AGATGGAAGAGGAAAGTGGAGGG + Intergenic
990171704 5:53058520-53058542 AGTTGAAAAAATAAGGAGGTAGG + Intronic
990758913 5:59106954-59106976 AGTTTAAAAAGGCAGGTGGTGGG - Intronic
990816841 5:59795348-59795370 AGAAGGAAAAGGAAAGTGGGAGG + Intronic
991513054 5:67401236-67401258 AGTTGGAAAAGGAATGGGACTGG + Intergenic
991975020 5:72177072-72177094 TGTTAGAAAACAAAGGTGGTAGG - Intronic
992195515 5:74335223-74335245 AGTTAGATAAGGAAGGCGGTTGG + Intergenic
993568476 5:89505607-89505629 GGTGTGAAGAGGAAGGTGGTTGG - Intergenic
994306513 5:98211856-98211878 AATTGGGAAGGAAAGGTGGTTGG + Intergenic
994702908 5:103159921-103159943 GGCTGGAAAAGGAAGGGGTTGGG - Intronic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
994898407 5:105736924-105736946 AGTTGGAACAGGAAGTTAATTGG - Intergenic
995400637 5:111737096-111737118 ATGTGGAAAAGTAAGGTGGTTGG - Intronic
996353286 5:122569572-122569594 AGTTGGAGGTGGTAGGTGGTGGG + Intergenic
996513146 5:124340127-124340149 AATGAGACAAGGAAGGTGGTAGG + Intergenic
998082583 5:139289116-139289138 GCTTGGAAAAGGAATTTGGTAGG - Intronic
998599730 5:143573177-143573199 ATTTGGGAAATGGAGGTGGTGGG + Intergenic
999891359 5:155981645-155981667 TGTTGGTGAAGGGAGGTGGTAGG - Intronic
1000282177 5:159791705-159791727 AGTTAGAGAAGGAAGGAGGAAGG + Intergenic
1000349739 5:160343947-160343969 AGTTGGCAAGGGAAGCTGGATGG - Intronic
1000432800 5:161170002-161170024 AGCTGGGAAAGGAAGTAGGTGGG - Intergenic
1001868919 5:175133335-175133357 AGGTGGGAAAGGAAAGTTGTTGG - Intergenic
1002367781 5:178726645-178726667 AAGTGGGAAAGGCAGGTGGTAGG + Intronic
1003099326 6:3165071-3165093 AGTTGGCATCTGAAGGTGGTGGG - Intergenic
1003226693 6:4212383-4212405 AGCTGGAGGAGGAAGGTGCTAGG - Intergenic
1003381807 6:5631135-5631157 AGCTGGGAAAGGAAGGTGTGAGG + Intronic
1003488727 6:6602063-6602085 AGAAGGGGAAGGAAGGTGGTAGG - Intronic
1003611984 6:7622107-7622129 AGTTGGTAAATGAAGGTGTGCGG + Intergenic
1005514847 6:26544193-26544215 AGTTGGGAAAGGGATGTAGTTGG - Intronic
1005604912 6:27467104-27467126 ATTTGAACAAGTAAGGTGGTGGG - Intronic
1005691850 6:28314173-28314195 AGTTGGAGAGGGGAGCTGGTTGG + Intergenic
1007499736 6:42287676-42287698 AGTGGGAATGGGGAGGTGGTGGG - Intronic
1007631740 6:43276690-43276712 AGCTGGGAAAGGAAGGGGGAGGG - Intronic
1007987617 6:46223143-46223165 AGTTGGACACGGAGGGTGGCAGG + Exonic
1008418288 6:51268313-51268335 ATTTTGAAAAGTAAGGTGGCTGG + Intergenic
1008645408 6:53509313-53509335 AGTCAGAGAAGGAAGGTGCTGGG + Intronic
1008960077 6:57257674-57257696 AGTTAGAAAAGGGAGGAGCTAGG - Intergenic
1009351305 6:62683140-62683162 AGTTGAAACAGGAATGCGGTGGG + Intergenic
1010254377 6:73741008-73741030 AGATGGAAAACCAAGGTGGCAGG - Intronic
1011193298 6:84756834-84756856 AGTTCGAAATGGATGGTGGCAGG - Exonic
1011599387 6:89045708-89045730 AGATGGAAAAGTATGATGGTGGG + Intergenic
1011783627 6:90818722-90818744 AGTTGGAAAAGCAAGGAAGAAGG + Intergenic
1012599963 6:101083512-101083534 AGTTGGGAAAGGAGGGAGGTGGG + Intergenic
1013105753 6:107025498-107025520 AGAGGGAGGAGGAAGGTGGTGGG + Intergenic
1013553421 6:111232779-111232801 ATTTGGAAAAGGAAAGGTGTAGG - Intergenic
1013598657 6:111684132-111684154 AGTTTGAGAAGGAGGGAGGTTGG + Intronic
1014033378 6:116736360-116736382 AGTTGGAAATGGGAGGTGACTGG + Intronic
1014337771 6:120159476-120159498 ATATGAAAAAGGAAGGTGTTTGG + Intergenic
1014368590 6:120576784-120576806 GGTTGGATATGGAAGGTGATGGG - Intergenic
1014557586 6:122852910-122852932 TGTTGGAGAAGGAAACTGGTGGG - Intergenic
1015742466 6:136471533-136471555 TGCTGGAAAAGGAAGTTGCTGGG + Intronic
1016395164 6:143616736-143616758 ATTTGGATAAGGAATGAGGTTGG + Intronic
1016412181 6:143795046-143795068 TGTTGGAAAAGAGAAGTGGTGGG + Intronic
1017041239 6:150310118-150310140 AGGTGGGATAGGAAGGTGGTGGG - Intergenic
1017413456 6:154194486-154194508 AATTGAAAAAGGAAGGTAGTAGG - Intronic
1018088331 6:160324449-160324471 ATTTTGATAAAGAAGGTGGTGGG + Intergenic
1018670730 6:166174729-166174751 GTTTAGAAAAGGGAGGTGGTGGG + Intergenic
1019438579 7:1034766-1034788 AGGAGGAAAAGGAGGGTGGAGGG - Intronic
1019769998 7:2877529-2877551 AGACGAAAAAGGAAGGTGCTGGG - Intergenic
1020282718 7:6658113-6658135 AATCAGAAAAGGAAGGAGGTTGG - Intergenic
1020394942 7:7704058-7704080 AGTTGGAAAAGGAAGATGTCTGG - Intronic
1020858973 7:13464170-13464192 AGTTAGTAAAGGAAGGAGCTAGG - Intergenic
1020992974 7:15224712-15224734 AGTTAGGAAAGGAAAGTGGTTGG - Intronic
1021312815 7:19113979-19114001 ATTTAGAAAATGGAGGTGGTTGG + Intronic
1021402227 7:20222555-20222577 AGTTGGAAAAGGCAAGGGGATGG - Intergenic
1022229061 7:28395529-28395551 AGTTGGAAAAAGAAAGGAGTAGG - Intronic
1022636349 7:32139748-32139770 AGCTGGAGAAGGAAGGATGTGGG + Intronic
1023119765 7:36897568-36897590 AGTAGGAGAAGGAAGCTGGATGG + Intronic
1023270319 7:38455638-38455660 GGTTGTAAAAAGATGGTGGTGGG - Intronic
1024785447 7:52902012-52902034 TGTTAGAAAAGTAAAGTGGTGGG - Intergenic
1027611793 7:80370058-80370080 GATTGGAAAAGTAAGGTGTTGGG - Intronic
1028587599 7:92467486-92467508 ATTTGGAAGAGGAAGGATGTGGG + Intergenic
1029364097 7:100106375-100106397 GTTTGGAAAGGGAAGGTGCTGGG - Intronic
1029885631 7:103867940-103867962 ACTTTGAAAAGGGAGGTGGGAGG - Intronic
1030377801 7:108773672-108773694 AGTTGGGAAGGGAAGGAGGGAGG - Intergenic
1031247897 7:119340494-119340516 AATTGTATAAGGAAGGTGGAAGG - Intergenic
1032651219 7:133880405-133880427 TGTTGGGAAAGGAGGGTGTTGGG + Intronic
1032748647 7:134813884-134813906 AGCTGGTAAAGGACGGTGGGTGG + Intronic
1032936165 7:136734300-136734322 ACTTGGAAAGGGCAGGAGGTGGG + Intergenic
1033200298 7:139362579-139362601 AGATGGAAAAGGTAGGTAGGAGG + Intronic
1033360010 7:140632365-140632387 ATGTGGATAAGAAAGGTGGTGGG + Intronic
1035284727 7:157799009-157799031 AGTTGGAGAAGAAAGGAGGAGGG - Intronic
1035878767 8:3220958-3220980 AGTTGGAAAGGAAAGGGAGTAGG - Intronic
1036589286 8:10153334-10153356 AGGAGGGAAAGGAAGGTGGAAGG - Intronic
1037020527 8:13964864-13964886 AGTTGACAGTGGAAGGTGGTAGG - Intergenic
1038175776 8:25181385-25181407 GGTTGGAAAAGGGAGGTCTTGGG + Intergenic
1038437167 8:27544235-27544257 AGATGGACAAGTAAGGAGGTTGG + Exonic
1038998957 8:32958351-32958373 AGAGGGAAAAGGATGGGGGTGGG - Intergenic
1040384303 8:46903324-46903346 AGGTGAAACAGGAAGGTGCTGGG - Intergenic
1041457791 8:58078974-58078996 AGTTGGAAAAAAAAGGTGTCTGG - Intronic
1042001180 8:64124922-64124944 AGTTGGAAGGGGGATGTGGTGGG + Intergenic
1042412249 8:68478823-68478845 CGTTGGCAAAGGGAGGTGATTGG - Intronic
1042502015 8:69519175-69519197 AGTTTGAATATGAATGTGGTGGG - Intronic
1042504096 8:69541106-69541128 TGGTGGAGCAGGAAGGTGGTGGG + Intronic
1042516286 8:69662831-69662853 AGGTGGGAAAGGGAGGAGGTGGG - Intergenic
1043397222 8:79850532-79850554 AGATGGAAAAGGCAGGGAGTGGG + Intergenic
1044119335 8:88375524-88375546 AGTTGGAGAGGAAAGGTGGGAGG + Intergenic
1044137328 8:88603652-88603674 AGTAGGAAAAGGCAGGCTGTGGG + Intergenic
1045554427 8:103201691-103201713 AGCAAGGAAAGGAAGGTGGTTGG + Intronic
1047285041 8:123480475-123480497 AGATGGAATAAGAAGGTTGTTGG + Intergenic
1047757908 8:127932510-127932532 AGTTGGATAAGGCAGGTGCTGGG - Intergenic
1048639773 8:136342348-136342370 GGCTGGAAAAGGAAGTTGGTGGG - Intergenic
1049141568 8:140959835-140959857 TGTTGGAAAAGGAGGGTGGTGGG - Intronic
1049816675 8:144606343-144606365 AGAAGGAAGAGGAAGGGGGTTGG - Intergenic
1050378683 9:5000799-5000821 AACTGGATAAAGAAGGTGGTTGG + Intronic
1050471833 9:6001178-6001200 AGTAGGAATAGAAAGGTGGATGG - Intronic
1051257748 9:15232350-15232372 AGGTGGAAACGGGAGGTGGGGGG + Intronic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1052692307 9:31830765-31830787 ACTTGGAAGGGTAAGGTGGTGGG + Intergenic
1052717615 9:32136266-32136288 AGTTGGGAAGGGGAGGTGATAGG - Intergenic
1053382139 9:37657894-37657916 GGATGGAATAGGAAGGTGGTGGG - Intronic
1054914273 9:70481422-70481444 GCTTGGTAAAGTAAGGTGGTTGG + Intergenic
1055316508 9:75039618-75039640 AGTTCGATAAAGGAGGTGGTTGG - Intergenic
1055420152 9:76131468-76131490 ACATGGAAAAAGAAGGTGTTTGG - Intronic
1055587982 9:77776161-77776183 AGCTGGAAAAGGGAGATGGGAGG - Intronic
1056304391 9:85274875-85274897 AGGTGGAAAAGGTAGTTAGTTGG - Intergenic
1056497287 9:87170723-87170745 AGTTGGAAAAAGGAGGTGGTTGG + Intergenic
1056761407 9:89417968-89417990 AGTTGGATCTGGCAGGTGGTTGG - Intronic
1056778650 9:89532964-89532986 AGGTGGACAAGGCAGGTGGAAGG + Intergenic
1057085073 9:92202534-92202556 TGTTGGAAGAGGGATGTGGTGGG + Intergenic
1057558747 9:96110786-96110808 AGGTGGAAAAGGAAGGGGTAGGG - Intronic
1057931317 9:99195977-99195999 AGAGAGAAAAGGAAGGTGGGAGG - Intergenic
1058226719 9:102372803-102372825 AGCTACAAAAGGAAGGTGGGAGG + Intergenic
1058310816 9:103499994-103500016 TGTTGGAAGAGGAATCTGGTGGG - Intergenic
1059176087 9:112171248-112171270 AGTAGAAAAAGGAAGGGGGTTGG - Intronic
1059350463 9:113660647-113660669 AGATGGAAAAGGAGGTAGGTGGG + Intergenic
1060174402 9:121486736-121486758 AGCTAGAAAAGCCAGGTGGTAGG - Intergenic
1060415021 9:123424080-123424102 AGTATAAAAAGGAAGGTGGTTGG + Intronic
1060720171 9:125971298-125971320 AGTTGGGAAAGGGAGGAGCTGGG + Intergenic
1062194846 9:135267257-135267279 TGGTGGGGAAGGAAGGTGGTAGG - Intergenic
1203673059 Un_KI270755v1:35206-35228 AGGTGGAGAAGGAAGGGGCTGGG + Intergenic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1186433621 X:9525010-9525032 AGTTGGCAATGGAAGTGGGTTGG + Intronic
1186622906 X:11260330-11260352 CATTAGAAAAGGAAGTTGGTGGG + Intronic
1187404260 X:18988392-18988414 AGTAGGAAAAATAAGGGGGTGGG + Intergenic
1187563130 X:20421014-20421036 AGATGGATAAGGTAGGTGGAGGG + Intergenic
1188086084 X:25903446-25903468 TGTTGCAACAGGAGGGTGGTGGG + Intergenic
1189180949 X:39004048-39004070 AGGTGGGAAAGGGCGGTGGTGGG + Intergenic
1189206242 X:39241609-39241631 AGATGAAAAGGGATGGTGGTGGG - Intergenic
1189723415 X:43944098-43944120 AGTTTGAGAAGGAACGTGGAAGG - Intergenic
1189921772 X:45909458-45909480 AGTTAGATAAGGGAGGTAGTGGG + Intergenic
1191938240 X:66448858-66448880 AGGTGGAAATGGATGGCGGTGGG + Intergenic
1192473407 X:71419318-71419340 AGTGGGAACAGGGAGGTGGGAGG - Intronic
1193667513 X:84340097-84340119 AATGGGAAAGGGAAGGTGGGAGG + Intronic
1194164740 X:90501499-90501521 AGTTCTAAAGGGAAGATGGTGGG + Intergenic
1194390073 X:93306278-93306300 AGTGGGAAAGAGAAGGTGGCTGG - Intergenic
1195448000 X:104975805-104975827 AGTTGGATAAGTGAGGTGGCTGG + Intronic
1196276372 X:113770086-113770108 ACTTCTAAAAGGAAGGGGGTAGG + Intergenic
1196495627 X:116321701-116321723 GGTTGGAAATGTAAGGTGTTTGG - Intergenic
1196941165 X:120777414-120777436 AGATGGGAAAGGGAGGTGGCAGG - Intergenic
1198322457 X:135532012-135532034 AGTTGCAGAAGGAAGGAGGGTGG + Intronic
1198448617 X:136743651-136743673 AGTTGAAGAAGGAGGCTGGTGGG - Exonic
1198669091 X:139058847-139058869 AGGTGGTAAAGTTAGGTGGTAGG - Intronic
1199074174 X:143510859-143510881 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199093168 X:143714120-143714142 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199215167 X:145254040-145254062 AGGTGGAGAAGGAAGGGGGATGG + Intronic
1199798659 X:151227862-151227884 AGGAGGGAAGGGAAGGTGGTGGG + Intergenic
1199880584 X:151971607-151971629 AGTTGGAATTGGAGGGTGGGTGG + Intronic
1200511000 Y:4079293-4079315 AGTTCTAAAGGGAAGATGGTGGG + Intergenic
1201978925 Y:19885700-19885722 AGTTTAAAAAGGAACGTGCTAGG - Intergenic
1202035976 Y:20635932-20635954 TCTTGCAGAAGGAAGGTGGTAGG + Intergenic