ID: 1128992477

View in Genome Browser
Species Human (GRCh38)
Location 15:72272455-72272477
Sequence GTGGCCGCCACCACGGGCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128992477_1128992486 13 Left 1128992477 15:72272455-72272477 CCTGTGCCCGTGGTGGCGGCCAC 0: 1
1: 0
2: 1
3: 14
4: 148
Right 1128992486 15:72272491-72272513 GCGAGTACTCACGGCGACCCCGG 0: 1
1: 0
2: 0
3: 1
4: 21
1128992477_1128992481 -9 Left 1128992477 15:72272455-72272477 CCTGTGCCCGTGGTGGCGGCCAC 0: 1
1: 0
2: 1
3: 14
4: 148
Right 1128992481 15:72272469-72272491 GGCGGCCACACAGGCCAGCCTGG 0: 1
1: 1
2: 1
3: 25
4: 298
1128992477_1128992483 4 Left 1128992477 15:72272455-72272477 CCTGTGCCCGTGGTGGCGGCCAC 0: 1
1: 0
2: 1
3: 14
4: 148
Right 1128992483 15:72272482-72272504 GCCAGCCTGGCGAGTACTCACGG 0: 1
1: 0
2: 1
3: 7
4: 267
1128992477_1128992487 14 Left 1128992477 15:72272455-72272477 CCTGTGCCCGTGGTGGCGGCCAC 0: 1
1: 0
2: 1
3: 14
4: 148
Right 1128992487 15:72272492-72272514 CGAGTACTCACGGCGACCCCGGG 0: 1
1: 0
2: 2
3: 3
4: 19
1128992477_1128992488 24 Left 1128992477 15:72272455-72272477 CCTGTGCCCGTGGTGGCGGCCAC 0: 1
1: 0
2: 1
3: 14
4: 148
Right 1128992488 15:72272502-72272524 CGGCGACCCCGGGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 37
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128992477 Original CRISPR GTGGCCGCCACCACGGGCAC AGG (reversed) Exonic
900331133 1:2135159-2135181 GCGGCCGCCACCACCTGGACGGG + Intronic
900362290 1:2294882-2294904 GTGGCCTCCAACCCAGGCACAGG - Intronic
904620450 1:31772025-31772047 GCCGCCGCCGCCACGGGCTCAGG - Intergenic
905631163 1:39519292-39519314 GTGGTCACCAGCCCGGGCACTGG - Intronic
905658059 1:39698868-39698890 GTGCCTGCCACCACTGCCACTGG + Intronic
905666595 1:39766879-39766901 GTGGTCACCAGCCCGGGCACTGG + Intronic
906320631 1:44813389-44813411 GGGGCCGCCACCTCAGCCACCGG - Exonic
906535914 1:46550906-46550928 AAGGCCGCCATCAGGGGCACAGG - Intronic
908278530 1:62503566-62503588 GTAGCTGCGACCACAGGCACAGG + Intronic
909615803 1:77606569-77606591 GTGGCCACCACCACTGGGACTGG - Intronic
912411465 1:109483511-109483533 GTGGCCGCCAGCCCGGGAAGGGG + Intronic
916729520 1:167553622-167553644 GCGGCCGGGACCACGGGGACTGG - Exonic
917712860 1:177704836-177704858 GTGGCCCCCACCAGAGGCCCTGG + Intergenic
918736527 1:188071271-188071293 GTGGCAGCCACCACAAACACTGG - Intergenic
919974332 1:202600874-202600896 GTGTCCACCACCAAGGGCCCTGG + Intronic
920117240 1:203629507-203629529 TTGGCCGCGACCCCGGGCTCAGG - Intronic
922240040 1:223749333-223749355 GTGGCCGGCGCCAGGGGCCCTGG + Intronic
924775270 1:247111653-247111675 GCGACCCCCACCACGGGCCCCGG - Exonic
1063462976 10:6226048-6226070 GTGGCCGGGACCACGGGCCAGGG - Intronic
1069604080 10:69729051-69729073 TTGGCCTCCACCTCGGGCGCAGG + Intergenic
1076944701 10:133637969-133637991 GTGGCCCCCTCCAGGGGCAGGGG - Intergenic
1077028690 11:453417-453439 GTGGCCCCCAGCTCGGGAACTGG - Intronic
1077139754 11:1019042-1019064 GGGGCCACCACCACGGCCACAGG - Intronic
1077317416 11:1925622-1925644 GTCGACGCCACCACGGGCTCTGG - Intronic
1077478294 11:2801283-2801305 GTGCCCGCCCCTACAGGCACAGG - Intronic
1077557936 11:3235100-3235122 AGAGCCGCCACCCCGGGCACGGG - Intergenic
1078403156 11:11045366-11045388 CTGGCAGCCACCACAGGAACTGG - Intergenic
1078474902 11:11621916-11621938 GTGGCCGCCGACACAGGCAGTGG - Exonic
1083254179 11:61486279-61486301 GTGGGAGCCACCAGGGGCCCAGG + Intronic
1083777397 11:64900883-64900905 TTGGCCCCCACCCCGGCCACAGG - Exonic
1084091434 11:66881623-66881645 GTGCCCTCCTCCACTGGCACTGG - Intronic
1087950488 11:104214732-104214754 GTGGCTGAGACCACAGGCACGGG + Intergenic
1089507608 11:118974332-118974354 GTAGCTGCAACCACAGGCACAGG + Intronic
1092808385 12:12248990-12249012 GTGGCAGCCACCACAGGCTCGGG + Intronic
1092928715 12:13295261-13295283 GTGGAAGACACCACGGGCATGGG - Intergenic
1094853218 12:34391620-34391642 GAGGTCTTCACCACGGGCACAGG + Intergenic
1095941495 12:47730079-47730101 GGGGCAGCCACCACAGGGACTGG + Intergenic
1103567431 12:121823493-121823515 GTGGCCGGCGCCACGGCCCCCGG - Exonic
1103590731 12:121990332-121990354 GTGGGCAACACCAGGGGCACAGG + Intronic
1105207525 13:18235928-18235950 GGGGACGCCACCAAGGGCATGGG + Exonic
1117042225 14:51777866-51777888 GTGGCCACCAGCACAGGCTCTGG - Intergenic
1117690392 14:58299347-58299369 GCTGCCGCCACCGCGGGCCCGGG + Intronic
1122972534 14:105158234-105158256 GCGGCCTCCACCAAGTGCACGGG + Intronic
1123661984 15:22572569-22572591 GTGGCCGCCACCACAGTGCCTGG + Intergenic
1124045024 15:26140691-26140713 GAGGCCATCACCAGGGGCACAGG + Intergenic
1124262233 15:28202976-28202998 GTGGCCGCCACCACAGTGCCTGG - Intronic
1124315781 15:28666812-28666834 GTGGCCGCCACCACAGTGCCTGG + Intergenic
1125723651 15:41857124-41857146 GTGGCCCTCACCATGGGCAAGGG + Intronic
1125760679 15:42093805-42093827 CTGGCCACCACCTGGGGCACCGG + Intronic
1125920013 15:43519808-43519830 GGGGCCTCTACCACGGGCATGGG - Intronic
1126371594 15:47952974-47952996 TTGGCCTCCACGATGGGCACTGG + Intergenic
1127994355 15:64144458-64144480 GTGTCCTCCACCACCTGCACAGG + Intronic
1128964265 15:72041752-72041774 GTGGCTGCCACCGCTGCCACCGG - Intronic
1128992477 15:72272455-72272477 GTGGCCGCCACCACGGGCACAGG - Exonic
1132738478 16:1399035-1399057 GTGGCTGCAACCAGAGGCACGGG + Intronic
1132869047 16:2107482-2107504 GGAGCAGCCACCACGGGCTCAGG + Intronic
1133295514 16:4750068-4750090 GAGGCCGCCACCTCCAGCACAGG + Exonic
1134417597 16:14057954-14057976 GTGGCCCCCACCCCTGGCTCTGG - Intergenic
1134550101 16:15134879-15134901 GGAGCAGCCACCACGGGCTCAGG + Intronic
1134718368 16:16368116-16368138 GGAGCAGCCACCACGGGCTCAGG - Intergenic
1135324845 16:21519851-21519873 TTGGCTGCCTCCTCGGGCACCGG + Intergenic
1136111073 16:28063811-28063833 GGGGCCGCCACGCCGGGCGCGGG + Intergenic
1136209412 16:28747085-28747107 GAGGCCGCCGCCAGGGGCAGGGG + Intergenic
1136336333 16:29613126-29613148 TTGGCTGCCTCCTCGGGCACCGG + Intergenic
1136476569 16:30517326-30517348 GTAGCTGAGACCACGGGCACGGG - Intronic
1138574904 16:57901319-57901341 CTGGCAGCCACCACGGGATCTGG - Intronic
1139489724 16:67279736-67279758 GGGGCCGCCCCCACGGGCATGGG + Exonic
1140932367 16:79639711-79639733 GTAGCTGACACCACAGGCACAGG + Intergenic
1141804568 16:86334287-86334309 GTGGCAGCCAGGAGGGGCACCGG + Intergenic
1141990862 16:87608752-87608774 GTGGCCCCCACATCTGGCACAGG - Intronic
1141995908 16:87636213-87636235 GAGGCCTCCACCACGTGCCCTGG + Intronic
1142037050 16:87868908-87868930 TTGGCTGCCTCCTCGGGCACCGG + Exonic
1142580624 17:940061-940083 GTAGCCGGGACCACAGGCACAGG + Intronic
1142855076 17:2724616-2724638 GAGGCCGCCGCCAAGGGCCCCGG - Intergenic
1147349969 17:39834895-39834917 GTGGCCTCCTCCACAGGCTCTGG + Intronic
1147582395 17:41634784-41634806 CTGGGAGCCAGCACGGGCACAGG + Intergenic
1148680952 17:49473170-49473192 GTGGCCACCACCAGGGTCAGAGG - Intronic
1150484201 17:65532764-65532786 GTTGCCGCCACCAGGGCCAGGGG - Intronic
1151831879 17:76557593-76557615 GTGGCCGCCACCAGGGGCAGTGG - Intergenic
1152421698 17:80196822-80196844 GTGGCCGCAATCACTGGCACTGG - Intronic
1153771818 18:8422843-8422865 GTGGCGGCCACCAGGGGCTGGGG + Intergenic
1160768172 19:817920-817942 GTAGCCGCCTCCAAGGGCTCAGG + Intronic
1160991941 19:1863676-1863698 GTGGCCGCCCCCGCGGGCTCCGG - Intergenic
1161272734 19:3398858-3398880 GCGGCTCCCTCCACGGGCACTGG + Intronic
1162307383 19:9883427-9883449 GTGGCGGCCACCTGGGTCACCGG + Intronic
1163559070 19:18008465-18008487 GGGGCCGCGCCCACGTGCACTGG + Exonic
1165027035 19:32969646-32969668 GTGGCTGCCCCCCCAGGCACAGG - Intronic
1165257459 19:34588398-34588420 GTGGCCGTCACCCAGGCCACAGG + Intergenic
1165364792 19:35358879-35358901 GTGGCCACCACCATGGATACAGG + Exonic
1165366610 19:35371348-35371370 GTGGCCACCACCATGGATACAGG + Exonic
1166983866 19:46648612-46648634 GTGGCGGCCACCGCGGCCTCTGG - Exonic
1167473983 19:49689793-49689815 GTGGCCGCAACTACGGGCCACGG + Exonic
1167475856 19:49700686-49700708 GTGGACAACACCACGGGCTCCGG + Exonic
925265197 2:2562081-2562103 GCTGCCGCCACCACTGGCTCTGG - Intergenic
927839507 2:26430487-26430509 GTGACTGCCAACAGGGGCACTGG + Intronic
929664618 2:43823936-43823958 GTGGGCGCCACCCCGTACACAGG - Exonic
929779703 2:44949739-44949761 GTGGCCGTCACCTGGAGCACCGG + Intergenic
934570948 2:95373004-95373026 ATGCCAGGCACCACGGGCACAGG + Intronic
934681221 2:96285280-96285302 GTGGGGGCCCCCACGGGCAGCGG - Exonic
944650401 2:201824541-201824563 ATGGCAGCCACCATGGGCTCAGG + Intronic
948050747 2:234977576-234977598 GGGGCTGGCACCACGGCCACAGG - Intronic
948645539 2:239401472-239401494 GTGGCCGTAAACACGGGCCCCGG + Intronic
948711689 2:239829193-239829215 GTGGCAGCCACCGCTGGCCCCGG - Intergenic
948711711 2:239829257-239829279 GTGGCAGCCACCGCTGGCCCCGG - Intergenic
1169214750 20:3786542-3786564 GTGCCCCCCGCCACGGGCCCGGG - Exonic
1173126987 20:40346194-40346216 GTGGCCACCACCACTGGGGCTGG - Intergenic
1174373977 20:50113106-50113128 ATGGCAGCCACCACGGGCTCGGG - Intronic
1174611427 20:51801458-51801480 GCGCCCGCCACCCCGGCCACTGG + Intronic
1176100036 20:63360673-63360695 GTGGCGGCCGCCAAGGGCAGAGG + Intronic
1176145726 20:63564593-63564615 CTGGCCGGCAGCATGGGCACTGG + Exonic
1178493162 21:33067223-33067245 GTGGCCGCTGGCACGGGCCCCGG - Intergenic
1179997616 21:44981237-44981259 GTGGACGACCCCACGGGCCCTGG - Intergenic
1183605459 22:38864934-38864956 GTGGCCTCTGCCACTGGCACGGG + Exonic
1185132158 22:49045369-49045391 GTGGCCGTGACCACGGGGACGGG - Intergenic
1185287602 22:50009515-50009537 GTGGCCGCCCCCAGGGGGCCTGG - Intronic
1185393743 22:50576546-50576568 GTGGCTGACACCCTGGGCACAGG + Exonic
954104959 3:48404996-48405018 GGGGCTGCCACCAAGGGAACCGG + Intronic
955006026 3:54969726-54969748 GTGGCAGCCACAGCAGGCACTGG + Intronic
957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG + Intronic
958593485 3:96190444-96190466 GTGGCTTCCACCTTGGGCACTGG - Intergenic
961360824 3:126366079-126366101 GTGGCAGCCAACACGGGTACAGG - Intergenic
961512141 3:127409602-127409624 GGGGCAGCCACCACGGGGGCCGG - Intergenic
962509473 3:136084319-136084341 GTGGACGCCACCAAGGGCTGGGG - Intronic
963864132 3:150342028-150342050 GTGTCTGGCACCCCGGGCACTGG + Intergenic
966057930 3:175718646-175718668 ATGGCAGCCACCACGGGCTCGGG - Intronic
966421918 3:179742320-179742342 GTTGCCGCCTCCATGGCCACAGG - Exonic
967840930 3:194003867-194003889 GTGGCCACCACGGCGGGAACCGG - Intergenic
968753402 4:2401940-2401962 CTGGCCACCACCACGCACACGGG - Intronic
970442542 4:16094040-16094062 GTGGCCACCACCACTGAGACTGG - Intergenic
972120397 4:35694645-35694667 GTGGCTTCCTCCATGGGCACTGG + Intergenic
972543000 4:40056148-40056170 GTGGCCGCTGCGGCGGGCACGGG - Intergenic
975666942 4:76741700-76741722 GTGGCCGCCGCCTCGGGGAACGG + Exonic
985448087 4:190038479-190038501 GTGGCCCCCTCCAGGGGCAGGGG - Intergenic
986451855 5:7873409-7873431 GTGGTTTCTACCACGGGCACCGG + Exonic
994233659 5:97337018-97337040 ATGGCAGCCACCAGGGGCTCAGG - Intergenic
997951409 5:138245464-138245486 GTGGCTGGGACCACAGGCACAGG + Intergenic
999153719 5:149443077-149443099 GTCCCCGCCACCAGGGGCATGGG + Intergenic
1002915346 6:1524183-1524205 GTGGCCGCAACCGCGGGCCGAGG + Intergenic
1003207028 6:4021733-4021755 GCGGCAGCCGCCACGCGCACCGG - Intronic
1003887394 6:10533877-10533899 GTGGCTGCGACCACAGGCAGGGG + Intronic
1005315589 6:24599835-24599857 GTGGCCTCCCCCACAGGCTCTGG - Intronic
1006008866 6:31025816-31025838 GTGGCCTCCACCACAGTCTCTGG + Exonic
1009471407 6:64031256-64031278 CTGGCCGGCACCACCGGCCCTGG + Intronic
1017680525 6:156859257-156859279 GTGCCCGCCACCACGTGTATGGG + Intronic
1018156733 6:160992018-160992040 GCCGCCGCCACCACCGCCACCGG + Exonic
1018635278 6:165854819-165854841 GTGGGCGCCGCCAAGGCCACGGG - Intronic
1018711408 6:166500407-166500429 GTGGCCACCACCACGGTCCAGGG + Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019338722 7:497476-497498 GTGACCGCCACCACGGCACCAGG + Intronic
1019599664 7:1874937-1874959 GTGGCCCCCACCCCGGGCCCCGG + Intronic
1020100016 7:5389254-5389276 GTGGCCGCCGCCAGGGGTCCGGG + Exonic
1022090948 7:27108008-27108030 GCGGCCACCACCACGGGCCGGGG - Exonic
1022622637 7:32000507-32000529 GTGGCTGCCATCATGGGCTCAGG - Intronic
1032100986 7:128977530-128977552 GTGCCCTCAACCACAGGCACAGG - Intronic
1032794049 7:135263460-135263482 GTGGCTTCCACCTTGGGCACTGG + Intergenic
1033867679 7:145713031-145713053 GTGACCACCACCACTGGGACTGG + Intergenic
1035450895 7:158976286-158976308 GTGGCCGCCCTCCCGGGTACAGG + Intergenic
1040866413 8:52052869-52052891 GTGGCTGCCACCACTGCCTCTGG + Intergenic
1057844782 9:98514991-98515013 GTGGCCTCCCCCACTGGAACTGG - Intronic
1062435388 9:136544687-136544709 GGGGCCGCCTCCAGGGGCACCGG + Intronic
1186461497 X:9751960-9751982 CTGGCCCCCAGCAGGGGCACAGG - Intronic
1192486652 X:71533321-71533343 GTGGCCGACAGCACAGGTACCGG + Exonic
1200049538 X:153421551-153421573 GTGGCCGCCACCGCGCTCCCAGG - Exonic
1200100670 X:153688056-153688078 GCCGCCGCCACCACCGCCACCGG + Intronic