ID: 1128992493

View in Genome Browser
Species Human (GRCh38)
Location 15:72272515-72272537
Sequence CCGCGCGCGGCCGCAGCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128992480_1128992493 30 Left 1128992480 15:72272462-72272484 CCGTGGTGGCGGCCACACAGGCC 0: 1
1: 0
2: 0
3: 21
4: 183
Right 1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG 0: 1
1: 0
2: 0
3: 20
4: 145
1128992484_1128992493 9 Left 1128992484 15:72272483-72272505 CCAGCCTGGCGAGTACTCACGGC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG 0: 1
1: 0
2: 0
3: 20
4: 145
1128992482_1128992493 18 Left 1128992482 15:72272474-72272496 CCACACAGGCCAGCCTGGCGAGT 0: 1
1: 1
2: 1
3: 9
4: 162
Right 1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG 0: 1
1: 0
2: 0
3: 20
4: 145
1128992485_1128992493 5 Left 1128992485 15:72272487-72272509 CCTGGCGAGTACTCACGGCGACC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG 0: 1
1: 0
2: 0
3: 20
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128992493 Original CRISPR CCGCGCGCGGCCGCAGCCGA CGG Exonic
903485696 1:23688318-23688340 CGGCGCGCGCCCGCAACCGCAGG - Intergenic
906027143 1:42682959-42682981 CGGCGCGCGGCCGCAGGGGGAGG - Intronic
912401535 1:109397693-109397715 CTGCGGGCGGCCGCAGCCGGGGG - Exonic
912798628 1:112707234-112707256 CCGCGCAGGGCCGCAGCCACCGG + Intronic
921355428 1:214281013-214281035 GCGCGCGGGGCGGCCGCCGAGGG + Intergenic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
922505344 1:226122541-226122563 CGGGGCGCGGGCGCAGCCTAGGG + Intergenic
922696928 1:227735556-227735578 CAGCGCGCGGACTGAGCCGAGGG - Intronic
922783319 1:228269979-228270001 CCCGGCGCGGCCGCGGCCGGGGG - Intronic
923141076 1:231162152-231162174 CCGCGCGACGCTGCAGCCGGCGG - Intronic
924289695 1:242524641-242524663 CCGCTCGGGACCGCAGCCGCCGG - Intronic
1063300317 10:4844864-4844886 CCGCACGGGGCCGCAGGTGAAGG + Intronic
1067091301 10:43266902-43266924 CAGCGCGCGGCCGGCGCCGGCGG + Intronic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1070566132 10:77605141-77605163 CCGCGCCCAGCCGCAGCCCAGGG + Intronic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1072294159 10:93993772-93993794 CCCCGCGCGGCAGGAGCCGGGGG + Intergenic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1073063521 10:100745672-100745694 GCGCACGCCGCCGCGGCCGAAGG - Intronic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1077121466 11:910855-910877 CCGCGCGCCGCCGCCGCGCACGG + Intronic
1082789221 11:57335732-57335754 CCTCGCGAGGCCGCAGCCTGAGG - Exonic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1084363706 11:68684711-68684733 CCGGGCGCAGCCGCAGCTCAAGG + Exonic
1084522846 11:69675109-69675131 CCGCCCTGGGCCGCAGCCGGCGG + Intronic
1085333045 11:75668677-75668699 CTGTGCGCCGCCGCAGCCGCAGG - Exonic
1085624854 11:78064094-78064116 CCTCCCGCGGCAGCAGCCCATGG - Exonic
1087856018 11:103092299-103092321 CCGCGGACTGCCGCAGTCGACGG - Intergenic
1091778649 12:3200402-3200424 CCGCGCGCCGGGGCAGCCCAGGG + Intronic
1098897814 12:76083970-76083992 CCCCGCGCGGCCGCCCCCAATGG + Intronic
1101253887 12:102958745-102958767 CCGCGCGCTGCAGCAGCTGCTGG + Exonic
1103562689 12:121800537-121800559 GCGCGGGCGCCCGCAGCCGAGGG - Intronic
1103828658 12:123762002-123762024 CCTCGGGCCGCTGCAGCCGAGGG - Intergenic
1107935225 13:45340845-45340867 CCGCGTGCGGCCGCCGGCGCGGG - Intronic
1112041523 13:95552730-95552752 GCGAGCGCGGCTGCAGCCGGCGG + Exonic
1113082828 13:106535550-106535572 CCGCGCGCGTCCGGAGCCCGCGG - Intergenic
1113200997 13:107867341-107867363 CCGCCCGCGGGCGCCGCCGCCGG + Intergenic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1121074925 14:91060230-91060252 GGGCGCGGGGCCGCAGCCGTGGG - Intronic
1124469302 15:29968899-29968921 CCACGCACGGCCGCAGCTGCGGG - Intergenic
1125508949 15:40282698-40282720 GCGTGGGCGGCTGCAGCCGAGGG + Intronic
1126348358 15:47718829-47718851 CCGCTCGCGCCGGCAGCCGCTGG + Exonic
1128119126 15:65133177-65133199 CTGCGCGAGGCCGAAGCCGACGG - Exonic
1128479250 15:68023139-68023161 CCGCGCCCGGCCCCACCTGATGG + Intergenic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1129440751 15:75579292-75579314 TCGCGGGCGGCCGCAGCGAAAGG + Intergenic
1132991754 16:2799010-2799032 CCGCGCGCGGGCGCTGGCCATGG + Intergenic
1133021465 16:2968796-2968818 CCTCACGCGCCCGCAGCCGTCGG - Intronic
1133284872 16:4686013-4686035 CCTCCCGCTGCCGCAGCCTAGGG - Intronic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1138588055 16:57984591-57984613 GCCCGCGCGGCCGTAGCCGCAGG - Intronic
1139664912 16:68448555-68448577 CCTCGCGCCGCCGGAGCCAATGG + Exonic
1142130787 16:88430656-88430678 CCGCCCGCCGCCCCAGCCGCCGG - Intronic
1142614444 17:1126395-1126417 CCGCTGGCGGCCCCAGCCCAAGG - Intronic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1148406789 17:47423422-47423444 CGGGCCGCGGGCGCAGCCGACGG - Intronic
1150211923 17:63446420-63446442 CCGAGCGTGGCCGCAACCGCGGG - Intergenic
1151818503 17:76483969-76483991 CCGCGCCCGGCCACAGCTGGGGG - Intronic
1151919145 17:77140867-77140889 GCGTGCGCGGCCGCGGCCGAGGG - Intronic
1152159983 17:78662027-78662049 CCGCGCCCGGCCCCAGCTGTAGG - Intergenic
1152245560 17:79183077-79183099 CCGCGCTCGGCCGCCGCGCAGGG + Intronic
1152352931 17:79793400-79793422 CCGTGCCCGGCCGGAGCCGCGGG + Exonic
1152922925 17:83074700-83074722 CAGCCCTCGGCCGCAGCCGGGGG + Intergenic
1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG + Intronic
1153794448 18:8609629-8609651 CCGCGCGCGGCGGAGGCCGAGGG + Exonic
1157794109 18:50559633-50559655 CCCCGCGCGGCTGCAGCCGCCGG - Intergenic
1158644868 18:59237158-59237180 CCGCGCCCGGCCTGAGCTGAGGG - Intergenic
1160663403 19:311976-311998 CAGGGCGGGGCCGCAGCGGAAGG + Intronic
1160663422 19:312033-312055 CAGGGCGGGGCCGCAGCGGAAGG + Intronic
1160663442 19:312090-312112 CAGGGCGGGGCCGCAGCGGAAGG + Intronic
1160663461 19:312147-312169 CAGGGCGGGGCCGCAGCGGAAGG + Intronic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160991982 19:1863780-1863802 CCGCGCGCGGCCGCCGGGGGCGG + Intergenic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161293114 19:3506359-3506381 CCGGCCGCGGCCGCCGCTGACGG - Intronic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161400244 19:4064129-4064151 CCGCGGGCGGCCGCAGGCAGTGG - Intronic
1162393496 19:10403562-10403584 CCGCGCTCGGCGGAAGCGGAAGG - Intronic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1162951351 19:14073576-14073598 CCGGTCGCCGCCGCAGCCGCTGG + Exonic
1163051812 19:14690056-14690078 GTGCGCGCGGCGGCGGCCGACGG + Intronic
1163122072 19:15223956-15223978 CTGCGCGCGGCCACAGCACAGGG - Intergenic
1163720476 19:18896095-18896117 CCGCGGGCGGGCGCAGGCGACGG - Exonic
1165851452 19:38852218-38852240 CCGCGCGCGGCCGGGGGCCAGGG - Intronic
1166043844 19:40218093-40218115 CCGAGCGCTGCTGCAGCTGAAGG - Exonic
1166106689 19:40601241-40601263 CCCCGCGCGGCCGCCGGGGAGGG + Intronic
1166727758 19:45039070-45039092 CCGCGCGCGAGCGCAGCGGTGGG + Exonic
1167148138 19:47694681-47694703 CCCAGCGCTGCCCCAGCCGAAGG + Exonic
926217204 2:10912880-10912902 CTGGGCGTGGACGCAGCCGAGGG + Exonic
926581437 2:14634964-14634986 CCACGCGCGTCCGCCGCCGGTGG + Exonic
927904616 2:26847942-26847964 CCGCGCGCCGCCGCCGCCTGGGG - Intronic
927904892 2:26848902-26848924 CCGCGCTGGGCTCCAGCCGAGGG - Intronic
927943250 2:27118842-27118864 CCGCGCGGCGCCGCAGCAGGTGG - Exonic
929174210 2:38960442-38960464 CCGCGTGCGCCGCCAGCCGACGG + Exonic
929218038 2:39436856-39436878 CCGCGCGCCGCCGAGGCCGTGGG - Intronic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
931671795 2:64654059-64654081 CCGCGGCCGGCCGCGGCCGCAGG + Intronic
932567686 2:72919977-72919999 CCGCGGGCCGCCGCGGCCGAGGG + Intronic
933772724 2:85754381-85754403 CCGGGACCGGCTGCAGCCGATGG - Exonic
941096686 2:161245164-161245186 CCCGGCGCGGCCGCGGCCGGGGG - Intergenic
941917845 2:170823712-170823734 CCGAGCGCTGCGGCCGCCGAAGG - Intronic
948369014 2:237475556-237475578 GCGCGCCCGGCTGCAGCCGTCGG + Intergenic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948824693 2:240568529-240568551 CCGCGCCGGGCCGCGGGCGAGGG - Intronic
948824699 2:240568542-240568564 CCCGGCGCGGCCGCCGCCCATGG + Intronic
1170578673 20:17682185-17682207 CAGCGAGCGGCCGGAGCGGACGG - Exonic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1175429266 20:58890974-58890996 CCTCCCGCGGGCGCCGCCGAGGG - Intronic
1176055029 20:63140853-63140875 CCGCGCACGGGAGCAGCCGGTGG - Intergenic
1179988183 21:44932556-44932578 CCACGCGCGGCCCCATCCGCAGG - Intergenic
1182355558 22:29720910-29720932 CCGCGGGCGGGCGCCGCGGAGGG - Intronic
1183942049 22:41301537-41301559 CCGCTCGCGGCAGCACCCGCTGG - Exonic
1184711218 22:46250493-46250515 CCGCGCGCTCCCGCAGCGCACGG - Exonic
1184782952 22:46658248-46658270 CCGCGAGCGGCAGCGGCGGATGG + Exonic
950036634 3:9890741-9890763 CCGCGAGCGGCCGGCACCGACGG + Exonic
953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG + Intronic
954367769 3:50155366-50155388 TCGGGCGCGTCAGCAGCCGAGGG - Exonic
958785719 3:98594182-98594204 CCGCGCCCGGCCCCAGCCTGGGG - Intergenic
961012933 3:123448179-123448201 CCGCGCCCCGCCGCTGCCGGCGG + Exonic
961665014 3:128489251-128489273 CCGGGCGCCCCCGGAGCCGAGGG - Intronic
967904070 3:194486698-194486720 CAGCGCGCGGCGCCGGCCGAGGG - Intronic
968556526 4:1248750-1248772 CCGCGCGTGGCCGCGGTCGGGGG - Intronic
968965171 4:3766010-3766032 CCGCGCCCGGGAGCAGCCGGAGG + Intergenic
969346755 4:6575108-6575130 CCGCCCCCGCCCGCAGCCAATGG + Intergenic
970194657 4:13542512-13542534 CCGCAGGCGACCGCAGCCCAAGG - Exonic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
981475101 4:145180089-145180111 CCGCGAGCGGCGGCAGGCGGCGG + Intronic
989102301 5:37834665-37834687 GGGCGCGCGGCGGCGGCCGAGGG + Exonic
991063636 5:62403728-62403750 CCGCCCGCGGCGGCGGCCGATGG + Exonic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1002140227 5:177133518-177133540 CCGCTCGCGGCCGGGGCCTACGG - Intronic
1002926814 6:1609827-1609849 CCGCCAGCGGCGGCAGCCAATGG - Intergenic
1007644437 6:43369468-43369490 CTGCGCGCCGCCTCAGCCGCGGG + Intronic
1009431624 6:63572501-63572523 CCGAGCCGGCCCGCAGCCGAAGG - Exonic
1013170820 6:107635023-107635045 ACGCGCGGCGCCGCCGCCGAGGG + Exonic
1014755858 6:125301685-125301707 CAACGCGCGGCCGCATCCGCAGG + Intronic
1016328180 6:142926828-142926850 CCGCGCCCGGCGGCCGCCGCAGG - Intronic
1016330275 6:142946572-142946594 CCGCCCGCAGCGGCAGCCGTGGG - Intergenic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1018876596 6:167827088-167827110 CCGCGCGGGGCCGGGGCCGGAGG - Exonic
1019197619 6:170291368-170291390 CGGGCCGCGGCGGCAGCCGAGGG + Intergenic
1019379040 7:711949-711971 CTGCGCGCGGCCTCAGGGGAGGG + Intronic
1019472878 7:1230426-1230448 CGCGGCGCCGCCGCAGCCGAGGG + Intergenic
1022100905 7:27168668-27168690 CCGCGTGGGGCGGCTGCCGAGGG - Intronic
1029298311 7:99558862-99558884 CGGCGTCCGGCCGCGGCCGACGG + Exonic
1033300079 7:140177301-140177323 GGGCGCGCGGCCGCAGCCGGAGG + Intergenic
1037769354 8:21789594-21789616 GCGCGCGGGGCCGGCGCCGAAGG - Intronic
1041355240 8:56993413-56993435 GGGCCCGCGGCCGCGGCCGATGG - Exonic
1041689900 8:60678705-60678727 CCGCGCGCACCCGAAGCCGCGGG - Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1041906450 8:63038628-63038650 CTGTGCGGGGCCGCAGCAGACGG - Intronic
1049237254 8:141518555-141518577 CCGCGCGCGGGCGCAGCTCAGGG - Exonic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049752224 8:144290733-144290755 CCCAGCGCGGCCGCGGCCGAGGG + Intronic
1050552247 9:6758380-6758402 CCGGCCGCGGCCGCAGGGGAGGG + Intronic
1053066428 9:35072372-35072394 CCGCGGGCCGCCACAGCCGCCGG - Exonic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1061281000 9:129597586-129597608 CTGCGCCCGGCTGCAGCCGCGGG - Intergenic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062364064 9:136200614-136200636 CCGAGCGCTGCTTCAGCCGAGGG - Exonic
1062658964 9:137618578-137618600 CCGCGCCAGGCCGCGGCCCAGGG + Exonic
1185460549 X:331121-331143 CCGGGGGAGGCTGCAGCCGACGG + Intergenic
1199772741 X:150984408-150984430 CCGCGCGCGGCCGGCGCGGGCGG - Intronic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic