ID: 1128992927

View in Genome Browser
Species Human (GRCh38)
Location 15:72275399-72275421
Sequence GAGAGATTCAAATGTTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128992927_1128992934 6 Left 1128992927 15:72275399-72275421 CCCTCCAAACATTTGAATCTCTC 0: 1
1: 0
2: 3
3: 28
4: 225
Right 1128992934 15:72275428-72275450 TTTCTGTTTCAGAAGTGGAGAGG 0: 1
1: 0
2: 4
3: 53
4: 467
1128992927_1128992932 1 Left 1128992927 15:72275399-72275421 CCCTCCAAACATTTGAATCTCTC 0: 1
1: 0
2: 3
3: 28
4: 225
Right 1128992932 15:72275423-72275445 CATCCTTTCTGTTTCAGAAGTGG 0: 1
1: 0
2: 1
3: 35
4: 277
1128992927_1128992935 7 Left 1128992927 15:72275399-72275421 CCCTCCAAACATTTGAATCTCTC 0: 1
1: 0
2: 3
3: 28
4: 225
Right 1128992935 15:72275429-72275451 TTCTGTTTCAGAAGTGGAGAGGG 0: 1
1: 0
2: 5
3: 66
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128992927 Original CRISPR GAGAGATTCAAATGTTTGGA GGG (reversed) Intronic
900242307 1:1623023-1623045 GAGACACTCACATGGTTGGACGG - Intronic
901924398 1:12556798-12556820 GAGAGATTCAAGTGGTTACATGG + Intergenic
904130082 1:28269013-28269035 GAGATATACACATGTTTGGAAGG - Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906165091 1:43680158-43680180 AAGATATTCAAATCTTTGAATGG + Intronic
906931356 1:50172797-50172819 GAGAGAATCAAATGCATAGAAGG + Intronic
907776759 1:57523289-57523311 AAAAGATACAAATATTTGGAAGG + Intronic
908110653 1:60894207-60894229 GAAAGATGCAATTGTCTGGAAGG + Intronic
910127735 1:83861656-83861678 GAGAGAATCCAGTGTTTGTAAGG + Intergenic
910256229 1:85249798-85249820 CAGAGCTTGGAATGTTTGGAGGG - Intergenic
910732074 1:90408591-90408613 GAGACATTCAAATGCAGGGAAGG + Intergenic
913173178 1:116250458-116250480 GAGAAATGCAAATGGTTGGTTGG + Intergenic
915494930 1:156275377-156275399 GAGAGCTTGAGATCTTTGGAAGG + Intronic
915704857 1:157833940-157833962 GAGAGTTTCAAATGTGCTGATGG - Intronic
916987428 1:170206855-170206877 CAGAGGTTGGAATGTTTGGAGGG + Intergenic
917398790 1:174623274-174623296 GAGATCTTCAAATTTTTTGATGG + Intronic
918529236 1:185499843-185499865 CAGATATTCAGATATTTGGAAGG - Intergenic
918835446 1:189458358-189458380 GAGAGAATAAAATATTTGGAAGG - Intergenic
921168643 1:212526115-212526137 GAGAGATTGAAAAGTGAGGAGGG - Intergenic
921579859 1:216883510-216883532 GAGAGATTCTATTGCTTCGATGG + Intronic
922856032 1:228775360-228775382 GAGAGATTCAAATCATGAGAGGG - Intergenic
924352051 1:243124769-243124791 GAAAGATACAAATGCTTTGAAGG - Exonic
924787749 1:247215336-247215358 GAGAAATTTAAATATTTTGAAGG - Intergenic
924842765 1:247731252-247731274 GAAAGGTTGAAAGGTTTGGAGGG - Intergenic
1063910124 10:10821014-10821036 GATAGATTCAAATGATTTCAAGG + Intergenic
1065438734 10:25727626-25727648 GAGAGATTGAACGGATTGGAGGG + Intergenic
1066316079 10:34247647-34247669 GAAAGATACAAATATTTTGATGG + Intronic
1067547225 10:47201686-47201708 CAGGTCTTCAAATGTTTGGATGG + Intergenic
1072553400 10:96495890-96495912 GAGAGATGTAAATGTTTTAATGG + Intronic
1072907195 10:99465298-99465320 GTGAGATTCATTTCTTTGGAAGG - Intergenic
1073618561 10:105023414-105023436 GAGAGTTTCCAATGGTTGGAGGG + Intronic
1075570706 10:123540496-123540518 GAGAGATACAATTGTGTGGATGG - Intergenic
1076301558 10:129431792-129431814 GGGAGATTCAAATATTTTGATGG + Intergenic
1077933476 11:6758054-6758076 GAGACATTCATTTGTCTGGAAGG - Intergenic
1079254812 11:18818864-18818886 TAGAGCTTCAGATGTTTGGTAGG + Intergenic
1080519496 11:33055206-33055228 GAGAGATTAAAATATTGGGGAGG + Intronic
1087141917 11:94772525-94772547 GAGAGATGCAAAAATTTGGATGG - Intronic
1087835630 11:102871968-102871990 GAGAGAGAAAAATGTATGGAAGG + Intronic
1092903436 12:13081236-13081258 GAGAGATGAAAATGCTTGGATGG - Exonic
1093166717 12:15812563-15812585 CAGAAATGCAAATGTTTGAAAGG + Intronic
1093769538 12:23002793-23002815 GAGAGATTTGAAGGTTTGGGTGG - Intergenic
1094388172 12:29918141-29918163 TAGAGATTCATATTCTTGGAAGG + Intergenic
1095074508 12:37900371-37900393 GAAACATTCAACTCTTTGGAAGG + Intergenic
1096316330 12:50570052-50570074 GAGAGATTCACTTGTTTGACTGG + Intronic
1097104118 12:56610606-56610628 TAGAGATACAAATGTGGGGAGGG - Intronic
1097544529 12:60982418-60982440 GAGAGATTCAAAAGATTTTAGGG + Intergenic
1097990843 12:65831696-65831718 GAGAAATGCAAATGATTAGAAGG - Intronic
1099395447 12:82132815-82132837 CAGATATTCCAATATTTGGAGGG - Intergenic
1099981866 12:89613400-89613422 TAGTGATTCAAATCATTGGAGGG + Intronic
1100124035 12:91402209-91402231 GAGATATTCAGATGTTTCCATGG - Intergenic
1101244321 12:102871000-102871022 GACAGACTCAGATGTTTGAATGG - Intronic
1102507094 12:113390493-113390515 AACAGATGGAAATGTTTGGATGG - Exonic
1104091532 12:125521716-125521738 GAGAGATTCAACTGTTGCGAAGG + Intronic
1108331535 13:49389793-49389815 GACAGGTCCAAATGTTAGGAAGG - Intronic
1109175190 13:59146371-59146393 GAGAGATGCAAATGTTCAGGAGG + Intergenic
1109969913 13:69754436-69754458 TTGAGCTTCAAATGTTTGGTAGG - Intronic
1110140961 13:72128950-72128972 GAGAGATCCAAATGGTTTAATGG - Intergenic
1110896544 13:80759980-80760002 GAAAGAGTTAAATGGTTGGAGGG - Intergenic
1111490230 13:88962613-88962635 GAGAGATTCAAATAATGAGAGGG - Intergenic
1112835970 13:103514413-103514435 CTGAGTTTTAAATGTTTGGATGG + Intergenic
1115140310 14:30163416-30163438 GAAAGATTGAGATATTTGGATGG - Intronic
1115353138 14:32418267-32418289 GAGTGATTCAGACGTTTGGAAGG - Intronic
1116097769 14:40393694-40393716 GAGAGAGTCAATAGTGTGGAAGG - Intergenic
1119061886 14:71483096-71483118 AAGACATTCAAGTCTTTGGAGGG + Intronic
1121973097 14:98377236-98377258 GAGAGCTTCAGATGTCTTGATGG - Intergenic
1122639145 14:103147094-103147116 GAAAGAGGCAAATGCTTGGAAGG - Intergenic
1126458005 15:48885489-48885511 GAGAGATTTGAATGCTTTGATGG + Intronic
1128156767 15:65396266-65396288 GAGAGGTTAAAGTGATTGGAAGG - Intronic
1128992927 15:72275399-72275421 GAGAGATTCAAATGTTTGGAGGG - Intronic
1129303892 15:74644303-74644325 GAGAGAATAAAGTGTTGGGATGG - Intronic
1130395574 15:83498201-83498223 GAGTGATGAAAATGTTTGGATGG - Intronic
1131693029 15:94846652-94846674 GAGAGGTTCAAATGTTGGCTGGG + Intergenic
1131875075 15:96797094-96797116 GATGGATTCAGATGTTTTGAAGG + Intergenic
1133140920 16:3743480-3743502 GAGAGATGGAAATGCTAGGATGG - Intronic
1135497231 16:22963182-22963204 GAGAAATTCAAGGGTTTGGTGGG - Intergenic
1136474073 16:30501277-30501299 GAAATATTAAAATGTTTGGCTGG + Intronic
1137491430 16:48936432-48936454 GAGAAATTCAATTCTTAGGATGG - Intergenic
1139026649 16:62826086-62826108 TAGAGATTAAAGTGTATGGAAGG + Intergenic
1143884223 17:10053972-10053994 GAGAAATTCAGATAGTTGGATGG - Intronic
1147431716 17:40375447-40375469 GTGAGTTTCTAATGTTTGAAAGG + Intergenic
1153203102 18:2666666-2666688 GAGTGTTTCAAATGAATGGAAGG + Intronic
1155558799 18:27052431-27052453 CAGAGATTGAACTGTTTAGATGG + Intronic
1155592843 18:27447634-27447656 GAGAGATACAAATGTTCAGGAGG + Intergenic
1155859281 18:30876667-30876689 GAGAGTTTCAAATGGTGGTATGG + Intergenic
1156689462 18:39689687-39689709 GACAACTTCAAGTGTTTGGATGG + Intergenic
1157637809 18:49178396-49178418 AAAAGATTCAAATGTGTGTAAGG + Intronic
1158008648 18:52702796-52702818 GAGATATTCAAATGTTTATCTGG + Intronic
1158402314 18:57132265-57132287 GAGAGATTAAAATGCTGGCATGG - Intergenic
1159766733 18:72500471-72500493 GAGAGATTCAGATATTTGATAGG - Intergenic
1161653108 19:5497376-5497398 GAGAGAATCAAAAGTTGAGATGG + Intergenic
1164311225 19:24048224-24048246 CAGAGATTCAAAGCTTAGGAAGG + Intronic
926319640 2:11740218-11740240 GAGGAATTCAACTGATTGGATGG + Intronic
927345799 2:22037851-22037873 GAGTGAGTCTAATCTTTGGATGG - Intergenic
928426700 2:31184374-31184396 GAAATATTCAGATGTTTAGAAGG - Intronic
928489813 2:31770083-31770105 AAGAGATTCTAATGATTAGATGG - Intergenic
928808804 2:35197605-35197627 CAGAGCTTAAAAAGTTTGGAGGG + Intergenic
928817293 2:35313893-35313915 TAGAGATACAGATGTGTGGAGGG + Intergenic
929325900 2:40610250-40610272 GAGAGATTCACATGATTAAAAGG - Intronic
930758462 2:55004404-55004426 GAGAGATTTAAATATTTGTCAGG - Intronic
931402073 2:61940654-61940676 GAGTGATAGAAATTTTTGGATGG - Intronic
931511084 2:62995544-62995566 AAGAGATTCACATGCTAGGAAGG + Intronic
932122092 2:69111314-69111336 GAGAGATTCAAATGCTAAAAAGG + Intronic
932156282 2:69420856-69420878 GTGAGATACAAATGTTTGATGGG - Intronic
932440708 2:71732888-71732910 GAGAGAATCAAAGGCTTTGAGGG - Intergenic
933387330 2:81628023-81628045 GAATGAATAAAATGTTTGGATGG - Intergenic
938161495 2:128988475-128988497 GAGAGATTCATATGTTCAGGAGG + Intergenic
939130739 2:138233291-138233313 GAGAAATTAAAATGTTTGGATGG + Intergenic
939218600 2:139272991-139273013 GGTTGATTCAAATGTATGGAGGG + Intergenic
939621207 2:144421067-144421089 GAGAGATGAAAATGTCTGGTTGG + Intronic
942180459 2:173375527-173375549 GAGCATTTCAAATGTTTGTATGG - Intergenic
942224457 2:173803204-173803226 GAGAGATTCATAAGTGTAGACGG + Intergenic
942716078 2:178893776-178893798 GAGAGAGAGAAATGTTTGGTGGG - Intronic
944024731 2:195150141-195150163 GGGAGATTTAACTGTTAGGATGG - Intergenic
945571556 2:211473921-211473943 GAGAGATTCAACTACTGGGAAGG + Intronic
946949677 2:224859894-224859916 GAGAAATTAAAATCTTTGGCTGG + Intronic
947182509 2:227424005-227424027 GTCAGATTCACATGTTTGAAAGG + Intergenic
947515495 2:230800613-230800635 GAGAGATTCCCCTGTGTGGAAGG + Intronic
949072108 2:242031594-242031616 ATGAGATTCAACTGTGTGGACGG - Intergenic
1169177847 20:3534183-3534205 GAGAAAATGAAATGTGTGGATGG + Intronic
1169282232 20:4277771-4277793 GAAACTTTCAAATGTTTTGAAGG - Intergenic
1169960988 20:11159875-11159897 GAGTGATCCAAATGCTTGGGAGG - Intergenic
1170549603 20:17465513-17465535 GAGAGATTCCACTGTGTGGGAGG + Exonic
1171051993 20:21867983-21868005 TAGAGAGTCAAATATTTGGCAGG + Intergenic
1171109183 20:22464795-22464817 GACAGATTCAAATGTACTGAAGG + Intergenic
1171150104 20:22820267-22820289 GCGAGATTCAAATCTATGGATGG + Intergenic
1173277885 20:41600281-41600303 GTGAGATTCAAATTGTTGGGAGG - Intronic
1173563038 20:44019940-44019962 AAGAGATTCAAGTCTCTGGAGGG + Intronic
1173760955 20:45560157-45560179 GAGAGATTCAAATGATGAGAAGG + Intronic
1173833587 20:46109876-46109898 GGGAAATTCATATGTTTGAAGGG - Intergenic
1177250581 21:18585827-18585849 GAAAGATTTAAATTTTGGGAAGG + Intergenic
1177682536 21:24391117-24391139 GAGAGAAACATGTGTTTGGAGGG + Intergenic
1177688052 21:24465752-24465774 GAGAGATTGAACCGTTTGGAAGG + Intergenic
1178200817 21:30403213-30403235 GAGAGATTTAACTGTTTAGAAGG - Intronic
1182058918 22:27382653-27382675 GGGAGACTCAAATGTGGGGAGGG - Intergenic
1184143675 22:42595501-42595523 TTGAGATTTAAATGTTTGGTAGG + Intronic
1184346543 22:43917146-43917168 GAGAGAAGCAAATGTTTGGAGGG + Intergenic
951836247 3:26986576-26986598 GAGAGAGTCAAATGATTGCAGGG - Intergenic
952850035 3:37720290-37720312 GCGGGAGTCAAATGTTTGAAGGG - Intronic
953900075 3:46834978-46835000 GAGAGAGGCAAATATTGGGATGG - Intergenic
953973587 3:47365934-47365956 GAGAGAGACAAATGTTGGCAAGG - Intergenic
954800493 3:53184377-53184399 GAAAGATTGAAATGCTTGGCCGG + Intronic
955426147 3:58792295-58792317 GCTAGATACAAATGTTTAGATGG + Intronic
956762893 3:72459349-72459371 GGGATAGACAAATGTTTGGAAGG + Intergenic
957551494 3:81711387-81711409 GAGAGTTGAAAATTTTTGGAAGG + Intronic
958596782 3:96236198-96236220 GAGGAATGCAAATGTTTGGGAGG - Intergenic
959444417 3:106421005-106421027 GAGTGACTCAAATGTTGAGAGGG + Intergenic
960026347 3:113015111-113015133 GACAGATACAAAAATTTGGATGG - Intronic
960968325 3:123120971-123120993 GAGAGATACAACTGGTTTGAGGG + Intronic
964677003 3:159294664-159294686 GAGACTTTAAAATGTTTTGAAGG - Intronic
969969924 4:11035912-11035934 AAGCCATTCAAATGTTTAGAAGG - Intergenic
970587636 4:17529846-17529868 GGGAGAATGAAATGTCTGGAGGG - Intergenic
972704209 4:41525674-41525696 GATAGATACATATATTTGGAAGG + Intronic
973287800 4:48439568-48439590 GAGAGACTCATTTGTTTGGGGGG - Intergenic
974365120 4:60936946-60936968 CAGATATTCAAAAGTTTGAATGG - Intergenic
974574126 4:63695060-63695082 GAGAAATTCAAATGTATAAAAGG + Intergenic
974788079 4:66648106-66648128 AAGTGATTGAGATGTTTGGAAGG - Intergenic
974874474 4:67686256-67686278 GCCATCTTCAAATGTTTGGAGGG - Intronic
975151167 4:71022443-71022465 GAGACAGGCATATGTTTGGAAGG - Exonic
976385810 4:84456635-84456657 GAGACATTCAAATTTCAGGAGGG + Intergenic
977512849 4:97983403-97983425 CAGATTTTCAAATGCTTGGAGGG + Intronic
978177724 4:105754744-105754766 AAGACATTAAAATGTTTGGAGGG + Intronic
978425771 4:108580596-108580618 CAGAGATTCAGATAATTGGATGG - Intergenic
979249890 4:118555756-118555778 GAAAGATACAAATGCTTTGAAGG + Intergenic
979369739 4:119870119-119870141 CAGAGACTCAATTGTTTGGCTGG + Intergenic
981256469 4:142666567-142666589 GAGATATTCTAATATTTGGTAGG - Intronic
984097793 4:175453209-175453231 GAGTGATAGAAATTTTTGGATGG - Intergenic
984526463 4:180864396-180864418 GAGAGAGTACAATGTTTGGGAGG - Intergenic
984726138 4:183023260-183023282 AAGTGATACAAAAGTTTGGATGG - Intergenic
985508214 5:296926-296948 ATGAGATTCAACTGTGTGGATGG - Intronic
985739824 5:1608745-1608767 ATGAGATTCAACTGTGTGGATGG + Intergenic
987226951 5:15852140-15852162 GAGATATTCCAAAGTTTGGAAGG - Intronic
989419286 5:41217221-41217243 AAGAGATTCATATGTTTAAAGGG - Intronic
991293130 5:65052233-65052255 GAGAAATCCAAATGTTAGCAAGG - Intergenic
991475583 5:67015413-67015435 GAGAAACTAACATGTTTGGAGGG + Intronic
992258156 5:74942788-74942810 GAGAGCTTCAAATGCTTACAAGG + Intergenic
993702754 5:91137604-91137626 GAAAGATTAAAATATTTGGAAGG + Intronic
994626755 5:102229845-102229867 GAGAGATTCAAATCTTGAGAAGG + Intergenic
994731398 5:103495696-103495718 GATAAATTCATATGTTTGTAAGG + Intergenic
995394138 5:111669679-111669701 GAGAGATTCAGAAGTTTGACAGG + Intronic
996471656 5:123868056-123868078 GAGAAATAAAAATGTTTGGGTGG + Intergenic
998397110 5:141825856-141825878 GAGAGATGCTTAGGTTTGGATGG + Intergenic
998884073 5:146675988-146676010 GAGTGATTGAATTGTTTGGAGGG - Intronic
999531948 5:152473332-152473354 GAGAGCTTCAAATGTGCTGAAGG + Intergenic
999680998 5:154059983-154060005 CAGACATTCAAAAGTTAGGAGGG + Intronic
1000560846 5:162787451-162787473 CAGAAATACAAATGTTAGGATGG + Intergenic
1003255342 6:4470446-4470468 GAGAGATACTAAAGTTTGCATGG - Intergenic
1004786471 6:18973572-18973594 GAGAAATTCCAAGGTTTGGGAGG - Intergenic
1007812433 6:44495901-44495923 GAGAGATTGTAATGGTTGGTAGG - Intergenic
1008081827 6:47203276-47203298 TAGAGATGCAAAAGTTTGGAAGG - Intergenic
1009435532 6:63614207-63614229 GAGTGAGTAAGATGTTTGGAAGG + Intergenic
1009711867 6:67333200-67333222 GAGAGATTTACATGATTGAATGG - Intergenic
1010058490 6:71592461-71592483 GAGAGAGTCAAATTCTTGGCAGG + Intergenic
1010143955 6:72644451-72644473 GAGAGGTTCAAATTTTTGGCTGG + Intronic
1010877028 6:81119220-81119242 GAGATGTTAAAATGTTTGTAAGG - Intergenic
1010905613 6:81484188-81484210 CAGAGATTTAAGTGTTTGGCAGG + Intergenic
1011711597 6:90060307-90060329 GAGAGGTTAATAAGTTTGGAGGG - Intronic
1012410641 6:98952993-98953015 AAGAGATGAAAATGTATGGAGGG - Intergenic
1012947679 6:105485379-105485401 GAGAGAAGCAAATGTTAGCATGG - Intergenic
1012957959 6:105591086-105591108 GAGAGATTCACAAGGCTGGAGGG - Intergenic
1013166341 6:107596194-107596216 GAGATATTAAAATGTTAGGGGGG - Intronic
1013229101 6:108145264-108145286 GAAAGATTCAAATGTCTTGAAGG + Intronic
1013824704 6:114197312-114197334 GAGATATTAAAATGTTTTTAAGG - Intronic
1014295877 6:119617140-119617162 CAGAGATTCAAATTTCTGCAAGG + Intergenic
1015347383 6:132175724-132175746 CAGAGGTTCAAAAGTTTGGAGGG - Intergenic
1018324859 6:162655658-162655680 GAAAGATTCAATTACTTGGAAGG + Intronic
1021402734 7:20228316-20228338 GAGAGATTCTTATCTTTGAAAGG + Intergenic
1022988974 7:35688683-35688705 AAGAGATTTATATGTTTGGCTGG - Intronic
1023331259 7:39119470-39119492 GAGAGAGTCAAATGGAAGGATGG + Intronic
1024857539 7:53798835-53798857 GAGAGATGAAATTGATTGGATGG - Intergenic
1026858043 7:73767980-73768002 GAGAGATTCAAATGACTGGATGG - Intergenic
1028244093 7:88455001-88455023 CAGAGATTTAAATGGTAGGAAGG + Intergenic
1028318586 7:89434589-89434611 GAGAGATTTGCATCTTTGGAAGG - Intergenic
1028505310 7:91564031-91564053 GAAAGAGAGAAATGTTTGGAAGG - Intergenic
1029856433 7:103521954-103521976 AAGAGAGTCAACTATTTGGAAGG + Intronic
1030665286 7:112270940-112270962 CAGAGATTCTAATGTATGGCTGG - Intronic
1031287371 7:119886762-119886784 CAGAGATTCAACAGTTTGGAGGG - Intergenic
1032174305 7:129611514-129611536 GAGCGCTTCAGAGGTTTGGAGGG - Intergenic
1034062627 7:148107085-148107107 GTGTGTTTCACATGTTTGGAGGG - Intronic
1034543174 7:151772622-151772644 TAGATATTCAAATGTTTTGGAGG + Intronic
1035424631 7:158761138-158761160 GAGATTTTCAGGTGTTTGGAGGG - Intronic
1037066924 8:14593271-14593293 GAGAGAAGCAAGTGGTTGGAGGG + Intronic
1037795618 8:21991600-21991622 AAGAGATTCATATGTGTGTAAGG - Intronic
1038962939 8:32541715-32541737 GAGAGATTCAGATGCTTTGATGG - Intronic
1039285794 8:36039494-36039516 GAGACATTCAAATCTTTTAAAGG - Intergenic
1039364660 8:36917146-36917168 AAGAGAGTGAAATCTTTGGAAGG - Intronic
1041122008 8:54595429-54595451 GTTAGTTTAAAATGTTTGGAGGG - Intergenic
1042105410 8:65321194-65321216 GATAGATTCAAAGGTGAGGATGG - Intergenic
1044784553 8:95780620-95780642 GAGAGGTTGAAACGTTTGTAGGG + Intergenic
1045067911 8:98468403-98468425 AAGAGATTCAGATATTTGTAAGG + Intronic
1045069137 8:98482378-98482400 GAGACAGTCAAATGTTTTTATGG + Intronic
1045136670 8:99228044-99228066 TAGAAATTCAAATATTTGAAAGG - Intronic
1046127717 8:109931035-109931057 AAAAGATTCAAATATTTGGTGGG + Intergenic
1046279578 8:112008331-112008353 GAGAGTTTTAACTGTTTTGATGG - Intergenic
1047722301 8:127652459-127652481 GAGAGATTCACACATCTGGATGG + Intergenic
1048010299 8:130450090-130450112 GAGAGGTACAAAGGGTTGGAAGG + Intergenic
1049809431 8:144557907-144557929 AAAAGATTCAAATATTTGAAAGG + Intronic
1050999363 9:12261136-12261158 ATGAGATTCTGATGTTTGGAAGG - Intergenic
1055485940 9:76756508-76756530 GAAGCATTCAAATGTTAGGATGG - Intronic
1055957104 9:81784632-81784654 GTAAGATTCAAATGTGTGAAAGG + Intergenic
1055988678 9:82081312-82081334 GAGGGGTTCAAATGTTTCTATGG + Intergenic
1057870632 9:98714291-98714313 GAGGGACTCATATGTTTGGAGGG - Intergenic
1059664978 9:116437911-116437933 GAGAGCCTCAAATTCTTGGAGGG + Intronic
1203395157 Un_KI270512v1:20876-20898 GAAAGTTTCAACTGTTTGGGAGG + Intergenic
1187042021 X:15606669-15606691 GAGAAATTCAAAACTTTGCATGG + Intergenic
1187210294 X:17223612-17223634 GAGGGATTCATTTTTTTGGAAGG + Intergenic
1187614201 X:20975477-20975499 GAGAAAATCATCTGTTTGGAAGG - Intergenic
1187922813 X:24222146-24222168 GAAAAATTTAAATGTTTGAAAGG + Intergenic
1188916896 X:35922423-35922445 GTGAGATGCAAATGTGTGCAAGG - Intronic
1192262749 X:69516974-69516996 GAGAGATTTGTATGTCTGGATGG - Intronic
1193226907 X:78994378-78994400 GAGAGATTAAAATGTTTGAGTGG - Intergenic
1193542153 X:82785711-82785733 GGGAGATTAAAATGTTGGAATGG + Intergenic
1193700150 X:84749958-84749980 CAGAGATACAAATGATCGGAAGG + Intergenic
1194032097 X:88830410-88830432 GAGAGATGACAATGTGTGGATGG - Intergenic
1195433052 X:104811007-104811029 GGCAGATTCAAATGCTTGCAAGG - Intronic
1196301350 X:114052584-114052606 GAGTGATAGAAATTTTTGGATGG + Intergenic
1197504520 X:127285163-127285185 GAGAGCTTTATATTTTTGGATGG + Intergenic
1200250488 X:154551242-154551264 GTGAGATTAAAATGTCTGGCCGG - Intronic