ID: 1128995765

View in Genome Browser
Species Human (GRCh38)
Location 15:72293248-72293270
Sequence CTCAGGTGACCCAGAAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128995758_1128995765 27 Left 1128995758 15:72293198-72293220 CCTTGATTGTGTTTGACAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 119
Right 1128995765 15:72293248-72293270 CTCAGGTGACCCAGAAATGGTGG 0: 1
1: 0
2: 3
3: 27
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128995765 Original CRISPR CTCAGGTGACCCAGAAATGG TGG Intronic
900461191 1:2802752-2802774 CTCAGGAGACCCAGACATCGAGG - Intergenic
900648477 1:3719576-3719598 CTCAGGAGACTCAGACAGGGAGG - Intronic
900690889 1:3979691-3979713 GTCAGGGGACCCAGAACTGCAGG - Intergenic
900961211 1:5921998-5922020 ATCAGCTGACCCTGAGATGGGGG + Intronic
902132097 1:14270895-14270917 CACAGTTTGCCCAGAAATGGGGG + Intergenic
903441979 1:23394965-23394987 CTCAGGAGACCAAGAAAATGAGG - Intronic
904447979 1:30589953-30589975 CTGAGGGGACTCACAAATGGAGG - Intergenic
908680053 1:66650564-66650586 GCCAGGAGACCTAGAAATGGAGG - Intronic
909506258 1:76393544-76393566 CTCAGGTGAAAAAGAAATGAAGG + Intronic
911165848 1:94723763-94723785 CTCAGATGGCGCAGAGATGGAGG - Intergenic
912414728 1:109500136-109500158 CAGAGGGGACCCAGAAATGCTGG - Intronic
913698339 1:121349549-121349571 CTCTGGTGACCACCAAATGGAGG - Intronic
914139213 1:144930493-144930515 CTCTGGTGACCACCAAATGGAGG + Intronic
915554324 1:156652945-156652967 GTCAGGTGACCCAGAGCTGCAGG - Intronic
915645151 1:157265257-157265279 ACCATGTGACCCAGAAATGTTGG - Intergenic
916347752 1:163813205-163813227 CTCAGATAACTCAGAAATGAAGG - Intergenic
917241165 1:172950050-172950072 CTCTTGTTATCCAGAAATGGGGG + Intergenic
919296919 1:195713738-195713760 CTCAGGTGGCCCAGACAGGAGGG + Intergenic
920485738 1:206368205-206368227 CTCTGGTGACCACCAAATGGAGG - Intronic
922762654 1:228142269-228142291 CTCAGGGGACCCAGGAAGAGCGG + Intronic
922908937 1:229199427-229199449 CTCAGGTGAGGCAGCAATGGTGG - Intergenic
923072479 1:230578184-230578206 GTCAGGTGAGCCAGGCATGGTGG - Intergenic
924059504 1:240157491-240157513 TTCAGATAACCCAGACATGGAGG - Intronic
1067550038 10:47227666-47227688 AGCAGGAGGCCCAGAAATGGGGG + Intergenic
1070370057 10:75773583-75773605 CTCAGGTGACCCACAACTCAAGG - Intronic
1070798073 10:79228703-79228725 CTCAGGGAACACTGAAATGGTGG - Intronic
1071093862 10:81950667-81950689 CTCAGATAACACAGAAATGCTGG - Intronic
1072016679 10:91354089-91354111 CTCATGTCACCCAGAAATCCAGG - Intergenic
1074824534 10:117205084-117205106 TTCAGATGACCCAGAGATGCAGG - Intronic
1077747382 11:4922007-4922029 CACTGGTGACTCAGAAATGTAGG - Intronic
1078557194 11:12338841-12338863 GTCAGGTTACCCACAAAGGGAGG - Intronic
1078560576 11:12367697-12367719 GTCAGGTTACCCACAAAGGGAGG + Intergenic
1082833087 11:57633918-57633940 CTCAGGAGAGTCAGAAATGGAGG - Intergenic
1083368528 11:62158552-62158574 GTCAGGTTACCCACAAAGGGAGG + Intergenic
1083889438 11:65588632-65588654 GTCAGATGACCCAGATGTGGGGG + Intronic
1084050126 11:66593939-66593961 CTCAGGTGCCCCAGAGACTGAGG + Intronic
1084096769 11:66916483-66916505 CTCAGGTCCCCCAGAAATTGAGG - Intronic
1086867659 11:91999698-91999720 CTCAGGTTATCCAAAAATTGTGG + Intergenic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1087269841 11:96100023-96100045 CTCATGTGAACCAGAAGTGAAGG + Intronic
1087416309 11:97860499-97860521 CTTAAGTGAGCCAGAAATGGAGG + Intergenic
1088542109 11:110923877-110923899 CCCAGGTGACACAGGAATTGTGG + Intergenic
1088558728 11:111090488-111090510 ATCAGCTGACCTTGAAATGGAGG - Intergenic
1091444018 12:533238-533260 CTGAGCTCATCCAGAAATGGAGG + Intronic
1092095597 12:5839413-5839435 CTCAGATGACTCGGCAATGGAGG + Intronic
1092964878 12:13631904-13631926 CTCAGATGAGGCAGAAAAGGCGG + Intronic
1094284017 12:28772316-28772338 TTCAGGTCACACAGAAATGGTGG + Intergenic
1095714279 12:45324915-45324937 CACAGGTGACTTAGAAAAGGTGG + Intronic
1096000922 12:48129623-48129645 CTCAAGTGACACAAAAAAGGGGG + Intronic
1096747369 12:53737741-53737763 CCCAGGTGGCCCAGAAAGGAAGG + Intergenic
1097092743 12:56520227-56520249 CTCAGGGGACACAGGAAGGGTGG - Intergenic
1100851400 12:98716115-98716137 CTCTGGAGAACGAGAAATGGGGG - Intronic
1101739223 12:107487320-107487342 CACAGGTGAGCCAAAAATGGAGG - Intronic
1102963267 12:117107461-117107483 ATCAGCTGACCCTGAGATGGGGG + Intergenic
1103917483 12:124383555-124383577 CTCAGGTGGCCCTGAGAAGGGGG + Intronic
1105421749 13:20258568-20258590 GCCAGGTGACCCAGAACAGGAGG + Intergenic
1106285483 13:28314854-28314876 CTCAGGTGACCTAGAGAGAGTGG - Intronic
1108836068 13:54550437-54550459 CTCATGGAAGCCAGAAATGGAGG + Intergenic
1111690280 13:91555481-91555503 CTCTGGTGGCCAAGAAATGGTGG - Intronic
1114397948 14:22383946-22383968 CTCAGGGGACCCTGAGATGTTGG - Intergenic
1115192409 14:30759830-30759852 CTAAGGTGACCCAGATCTGTTGG - Intergenic
1116171431 14:41407514-41407536 CTTTGATGACCCAGAAATGGAGG - Intergenic
1118711295 14:68521741-68521763 CTCTGGGGATTCAGAAATGGAGG - Intronic
1119129107 14:72155337-72155359 CTCAGGGTACTCAGGAATGGTGG - Intronic
1119671839 14:76525895-76525917 GTCAGATGATCCAGAGATGGTGG - Intergenic
1119758707 14:77136607-77136629 CTCAGCTGATCCAGAGAGGGAGG - Intronic
1120908145 14:89639004-89639026 CCCAGATAACCCAGAAACGGGGG - Intronic
1122261039 14:100523241-100523263 CAAGGGTGACCCAGAAATGTGGG + Intronic
1122407444 14:101508862-101508884 CTCAGCTCACCCAGAGGTGGGGG - Intergenic
1124178989 15:27455880-27455902 CCCAGGGGTCCCAGAATTGGAGG - Intronic
1125144811 15:36454481-36454503 CCCATGTGACCCATCAATGGTGG - Intergenic
1125926380 15:43566611-43566633 CTCTGGTGACCCCGAAATCCTGG - Intronic
1125939524 15:43666161-43666183 CTCTGGTGACCCCGAAATCCTGG - Intronic
1126356763 15:47804224-47804246 CTCAGGTGAGCCAGGAGTGGTGG + Intergenic
1128995765 15:72293248-72293270 CTCAGGTGACCCAGAAATGGTGG + Intronic
1131268202 15:90931188-90931210 CTCAGGAGACACAGAAAAGATGG + Exonic
1137004254 16:35258303-35258325 CTGGGTTGAGCCAGAAATGGCGG - Intergenic
1138452057 16:57099031-57099053 TTCTGGTGACCCAGATATGTTGG - Intronic
1141194308 16:81848516-81848538 CACAGGTTACCCAGACAAGGAGG - Intronic
1141577870 16:84976362-84976384 CCCACGAGACCCAGAAAAGGTGG - Exonic
1142977629 17:3655322-3655344 CTCAGGTGATCATGAATTGGAGG + Exonic
1143112080 17:4558533-4558555 CTCAGCTGGCCCAGAACTGCTGG - Exonic
1144656221 17:17038749-17038771 CTCAGGTGAGCCCCAAATGCAGG - Intergenic
1144889840 17:18488328-18488350 GTCAGGAGACCCAGGTATGGTGG + Intronic
1145142374 17:20455989-20456011 GTCAGGAGACCCAGGTATGGTGG - Intronic
1145235702 17:21206767-21206789 CTCAGGTGATCCCAAAATGCTGG + Intronic
1145908164 17:28527636-28527658 GTGATGTGAGCCAGAAATGGGGG + Intronic
1146442700 17:32910894-32910916 CTAAGGTGGTCAAGAAATGGAGG + Intergenic
1146817206 17:35952347-35952369 CTCAGGTGACCCCAAAGTGCTGG + Intergenic
1147055331 17:37829864-37829886 CTGAGGAGTCCCAGAACTGGTGG - Intergenic
1147897305 17:43758982-43759004 CCCAGGTGACCCAGAGAGAGGGG + Intergenic
1149197915 17:54145105-54145127 CTCAGGGCAGCCAGGAATGGGGG - Intergenic
1149441120 17:56674780-56674802 CTCAGGTGACAAAGAAAAAGTGG + Intergenic
1152431484 17:80250548-80250570 CTCCTCTGACCCAGACATGGTGG + Intronic
1152623917 17:81379760-81379782 CACAGGTGAGCCAGCAGTGGCGG + Intergenic
1154059517 18:11046652-11046674 CTCAGGAGAACAAGAGATGGAGG - Intronic
1156364729 18:36415061-36415083 GTGAGGGGACTCAGAAATGGAGG - Intronic
1156383185 18:36582292-36582314 CTCAGATGACCCAAATATGGGGG + Intronic
1157731280 18:50006593-50006615 CTCAGGTGTCACAGAAGGGGGGG - Intronic
1157773449 18:50371386-50371408 CTCTGGTGGCACAGAAATTGGGG + Intergenic
1159520537 18:69515452-69515474 CTCAGGTGGCCCAGAAACAAAGG - Intronic
1159891946 18:73961342-73961364 CTGAGGTGACCCTAAAAGGGTGG + Intergenic
1160521378 18:79510178-79510200 ATCAGGTGACCCTGAAGTGACGG - Intronic
1161283732 19:3458585-3458607 CTCTGGGGACCCAGAAAGGGTGG + Intronic
1163321568 19:16577732-16577754 ATGAGCTGAGCCAGAAATGGTGG + Intronic
1163610563 19:18299262-18299284 CTCAGGTGATCGAGAAACGCTGG + Intergenic
1163799769 19:19357269-19357291 CCCTGGAGACCCAGAGATGGCGG - Exonic
1165132517 19:33641632-33641654 CTCAGATAGCCCAGAAATGAGGG + Intronic
1165226156 19:34356698-34356720 ATCATGAGACCCACAAATGGAGG + Intergenic
1165802912 19:38563864-38563886 CCCAGGTGACACAGACAAGGTGG - Intronic
1166101254 19:40572628-40572650 CTCAGGTGAGACTGGAATGGAGG + Intronic
1167390252 19:49190209-49190231 CTCTGCTGACACAGAAGTGGTGG + Exonic
1168243293 19:55097810-55097832 CTCAGGGGGCCCAGATATGGGGG - Intronic
1168328595 19:55552375-55552397 ATCATGTGAGCCAGACATGGTGG + Intergenic
926731729 2:16040687-16040709 CTCAGGAGACCCAGGAGAGGTGG + Intergenic
927600902 2:24439901-24439923 CTTAGGTGACACAGAAAGGCTGG - Intergenic
928023591 2:27722293-27722315 ATCATGTGACCCAAGAATGGAGG + Intergenic
929378322 2:41317985-41318007 CTCAGGTAAGCCATAAATGTTGG + Intergenic
929465327 2:42138759-42138781 CTCAAGTAATCCAGAAAAGGAGG + Intergenic
930261639 2:49153903-49153925 CTTAGGAGACCCAGAATTGGAGG - Intronic
930910556 2:56624259-56624281 CTCTGGTGACTAAGTAATGGAGG - Intergenic
933622471 2:84558832-84558854 ATTAGGTTACCCAGAAATGTAGG - Intronic
934072576 2:88398164-88398186 TTCAGGGGACAGAGAAATGGAGG - Intergenic
935107299 2:100056815-100056837 CTGAGGTGAACCAGAAAGTGTGG - Intronic
935686053 2:105683968-105683990 TTCAGGTGACTCAGAAATCATGG - Intergenic
937116243 2:119406967-119406989 CTCAGTTTACCCAGTGATGGGGG - Intergenic
937154478 2:119709386-119709408 CTTTGGTGAGCCAGACATGGTGG + Intergenic
938061031 2:128254409-128254431 CTCATGTGTCCCAGACTTGGAGG + Intronic
938580907 2:132645786-132645808 CTCCGGTTACACAGACATGGGGG + Exonic
938949348 2:136242756-136242778 GCCAGGTCACCCAGAGATGGAGG - Intergenic
939638267 2:144609151-144609173 CTATGGCCACCCAGAAATGGGGG + Intergenic
940118282 2:150234685-150234707 CTATGCTGACCCTGAAATGGAGG - Intergenic
940422800 2:153499251-153499273 CTCAGGAGACCCAAAATGGGTGG + Intergenic
941278190 2:163517176-163517198 CTCTGTTGAGCCAGCAATGGAGG + Intergenic
944128854 2:196324236-196324258 CTCAGATCTCCAAGAAATGGAGG + Intronic
946186939 2:217986376-217986398 CTCTGGTGAGCCTGGAATGGGGG - Intronic
948119984 2:235522835-235522857 CACAGGTTGCCCAGAAATGCAGG - Intronic
948469147 2:238166303-238166325 CACAGCAGAGCCAGAAATGGAGG + Intronic
1168794346 20:601449-601471 CTCAGGTGACCCACCCATGTTGG - Intergenic
1168974490 20:1953920-1953942 TCCTGGGGACCCAGAAATGGGGG - Intergenic
1170249704 20:14266839-14266861 ATCAGGTCACCCAGAAAGTGGGG + Intronic
1171976420 20:31597518-31597540 CTAAGGTGACTCAGGAAAGGAGG + Intergenic
1172179461 20:32992366-32992388 CTTAGGTGCCCCTGAAATTGGGG + Intronic
1172558620 20:35865973-35865995 CTCAGGTGACCCACCCATGTTGG - Intronic
1174167818 20:48597855-48597877 CCCAGGTGACCCTGAAATGAAGG + Intergenic
1174258326 20:49275833-49275855 TTCAGGTGACTCAGACATGGAGG - Exonic
1174485374 20:50857828-50857850 CTCAACAGAACCAGAAATGGGGG - Intronic
1175286622 20:57840958-57840980 CTGAGGACACCCAGAAATGGTGG - Intergenic
1175721574 20:61290694-61290716 CTCCAGTGACACAGAAATTGGGG - Intronic
1176070256 20:63222555-63222577 TGCAGGTGGCCCAGAAAGGGAGG + Intergenic
1176252184 20:64130690-64130712 CGCAGATGTCCCAGGAATGGGGG + Intergenic
1176344266 21:5727444-5727466 GTCAGGTTACCTACAAATGGAGG - Intergenic
1176351080 21:5848028-5848050 GTCAGGTTACCTACAAATGGAGG - Intergenic
1176500561 21:7597012-7597034 GTCAGGTTACCTACAAATGGAGG + Intergenic
1176538587 21:8125513-8125535 GTCAGGTTACCTACAAATGGAGG - Intergenic
1178430589 21:32515249-32515271 TACAGGTGAACCAGAACTGGAGG - Exonic
1179681050 21:43021697-43021719 GTCAGGTGAGCCAGAAAAGTGGG + Intronic
1180676250 22:17588411-17588433 CTCAGGTGATCCAAAAGTGCTGG - Intronic
1181264410 22:21622398-21622420 CTGTGGTGGCCCCGAAATGGGGG + Exonic
1181485507 22:23228961-23228983 CCCAGGTGTCCCAGAAAGAGAGG - Intronic
1182464065 22:30503639-30503661 GTCAGGGGACGCAGAAAGGGAGG - Intronic
1183720203 22:39557926-39557948 CTCAGCTGATCCTGAATTGGCGG + Intergenic
1183828664 22:40406658-40406680 CTCAGGTGGCCCAGGATGGGGGG + Exonic
1183986719 22:41574218-41574240 CCCAAGGGACCCAGAAAGGGAGG + Intronic
1203243533 22_KI270733v1_random:41868-41890 GTCAGGTTACCTACAAATGGAGG - Intergenic
951356094 3:21668227-21668249 CTAAGGTGACCCTTAAGTGGAGG + Intronic
953288267 3:41634461-41634483 CTCATGTGACCCAGGGATGGAGG - Intronic
957392950 3:79602449-79602471 CTCAGCAGGACCAGAAATGGAGG + Intronic
958121868 3:89300894-89300916 ATCAGGTAACTCAGAAATGAAGG - Intronic
958723386 3:97874131-97874153 TTCTGGTCACTCAGAAATGGCGG + Exonic
960465606 3:117993710-117993732 CCCAGGTGAACCAGAGATGGGGG + Intergenic
961439359 3:126943586-126943608 CTCATGTCACCCAGAAAAAGGGG - Intronic
962066713 3:131989135-131989157 CTCAGGTGCCACACAAAGGGTGG + Intronic
964955081 3:162344795-162344817 CCAAGGTGACCCCAAAATGGTGG + Intergenic
965388900 3:168080716-168080738 CTCACCTGACACAGAAATGCAGG + Intronic
965616977 3:170603938-170603960 CTCATGCAACCGAGAAATGGAGG + Intronic
966101033 3:176269340-176269362 CACACCTGACCCAGAAAGGGAGG - Intergenic
966931422 3:184678170-184678192 CTCAGCTGACCCAGAAACCCCGG + Intronic
967555462 3:190851585-190851607 CTCAGCTGAGCCTGAAACGGAGG + Intergenic
967769768 3:193321705-193321727 GAAAGGTGCCCCAGAAATGGTGG - Exonic
968414553 4:418912-418934 GTCAGGTGATCCAGAAATCTAGG - Intergenic
968447713 4:660689-660711 CTCAGGTGCCCCAGAAGGTGAGG + Intronic
968476827 4:814537-814559 CTCATGCGACCCGGAGATGGAGG + Intronic
968612967 4:1565359-1565381 CTCAGCTGGGCCAGAAATGGGGG + Intergenic
969073292 4:4557126-4557148 TTCAGTGGACCAAGAAATGGAGG - Intergenic
969475356 4:7419424-7419446 CTCAGGTTACAGAGAAAGGGTGG + Intronic
971311738 4:25530977-25530999 GTCAGAAGACCCAGAAGTGGGGG + Intergenic
975536280 4:75454522-75454544 CTCAAGTGACCATCAAATGGTGG + Intergenic
976611463 4:87035070-87035092 CCTAGGTATCCCAGAAATGGAGG + Intronic
976772906 4:88673924-88673946 CTCAGGTGAGCCAGCAAGGCAGG - Intronic
977448869 4:97168342-97168364 TTCAGTTGACACTGAAATGGAGG - Intergenic
978201128 4:106024478-106024500 CTCAGGGGAGGCAGAAATAGTGG - Intergenic
979861839 4:125703527-125703549 CTCAAGTGGCCCATAAATGATGG - Intergenic
980818164 4:137975980-137976002 CTCAGGTGATCCACACATGTAGG + Intergenic
985926628 5:3024440-3024462 CTCAGCTGCCGCAGAAATCGGGG + Intergenic
986032356 5:3906043-3906065 CTCAGGTGTCCCAGAAAGTCAGG + Intergenic
990047960 5:51457755-51457777 ATCAGGTGACCCTGAGATGGAGG + Intergenic
990241040 5:53816947-53816969 CTCTAGTGACCCAGAAACAGGGG - Intergenic
990252473 5:53930332-53930354 CTCAGGTGACCAAGAAATGTTGG - Intronic
990738155 5:58886828-58886850 CTCAGGTCACCCTGGCATGGTGG + Intergenic
993291820 5:86081996-86082018 TTCAGGTTACCCATAAAGGGAGG - Intergenic
993433205 5:87857687-87857709 CTCAAGTGACCCAGAATAGCCGG + Intergenic
993884696 5:93401899-93401921 CTCAAGTGACCCAGAAATGCAGG - Intergenic
996747406 5:126857269-126857291 CTGAGCTGGCCCAGACATGGAGG - Intergenic
998443870 5:142183867-142183889 CTCAGCTGACACAGTGATGGTGG + Intergenic
999508077 5:152219048-152219070 CTCAGATCACCCAGGATTGGAGG - Intergenic
1000446740 5:161331532-161331554 CCCAGGCAACCCAGAACTGGGGG + Intronic
1000601962 5:163285693-163285715 CACAGGTGGCCAAGAAATGGTGG + Intergenic
1000834310 5:166135397-166135419 GTCAGGTGTCCCTGAAATGGAGG + Intergenic
1000997056 5:167969964-167969986 ATTAGGAGACCCTGAAATGGAGG + Intronic
1001547439 5:172579327-172579349 CTCTGCAGACCCAGAATTGGAGG - Intergenic
1002032587 5:176441449-176441471 CACATGTGACCCAGAAGTGCAGG - Intergenic
1002211332 5:177600998-177601020 CTCAAGTGCCCCACGAATGGAGG - Intronic
1003267331 6:4577312-4577334 CTCAGGTGGCCCAGGTATGGAGG + Intergenic
1003414658 6:5897183-5897205 TTCAGGTGTCCGAGAAATGCAGG - Intergenic
1005208347 6:23431147-23431169 CTCAGGTTACCCACAAAGGCAGG - Intergenic
1007546708 6:42699815-42699837 CTCATGAGCCCCAGAGATGGAGG + Intronic
1007546956 6:42701590-42701612 CTCATGAGCCCCAGAGATGGAGG - Intronic
1009626757 6:66145397-66145419 CTCAGGGAACCCAAAAATTGGGG - Intergenic
1011318527 6:86064179-86064201 GTCAGGTTATCCACAAATGGAGG - Intergenic
1012882917 6:104813198-104813220 CTCAGTTCATCCAGACATGGTGG + Intronic
1013115855 6:107103271-107103293 GGCAGGTGACCAGGAAATGGAGG - Intronic
1013412986 6:109898127-109898149 ATGAGGTGACACAGAAATGTGGG + Intergenic
1015695539 6:135976015-135976037 CTCAGGGAACCCAGAAATGGTGG + Intronic
1021633395 7:22667837-22667859 CTCATGTGACTCAGAATTTGAGG - Intergenic
1022394611 7:29975370-29975392 CCGTGGGGACCCAGAAATGGCGG + Intronic
1022403451 7:30063891-30063913 TGCAGGTGGCCCAGGAATGGTGG - Intronic
1022666678 7:32417202-32417224 CTCAGGGCACCCAGAAAAGCTGG + Intergenic
1023051559 7:36257207-36257229 ATCAGGTTACCCACAAAGGGAGG - Intronic
1023115001 7:36854171-36854193 CTATGGTGACCTAGCAATGGTGG + Intergenic
1023311161 7:38887784-38887806 GTCAGGTCACCCACAAAGGGAGG + Intronic
1023856389 7:44186745-44186767 TTCAGGCCACCCAGAAGTGGTGG + Intronic
1024954003 7:54896720-54896742 GTCAGGGGACCCAGTAATCGGGG - Intergenic
1026635648 7:72079620-72079642 CCATGGTGACCCAGAAATGTAGG - Intronic
1030401961 7:109063025-109063047 CACAAGAGACCCTGAAATGGAGG + Intergenic
1031749987 7:125559636-125559658 CTCAGGAGAGCCAAGAATGGAGG - Intergenic
1032800898 7:135316613-135316635 CTCAGGGAAGCCAGAAATGTAGG + Intergenic
1035047869 7:155981051-155981073 CACAGGGGACCCAGAGATGGAGG + Intergenic
1035745727 8:1961072-1961094 CCCAGGTGACCTAGGAATGCAGG + Intergenic
1036768205 8:11562400-11562422 CTGGGGAGACCGAGAAATGGAGG + Intronic
1039485474 8:37906402-37906424 ATCAGGAGAACTAGAAATGGTGG - Intergenic
1040958083 8:53000653-53000675 CTCAGGTGTTCCAGGAGTGGAGG - Intergenic
1042256918 8:66814608-66814630 CCCAAGTGAAGCAGAAATGGTGG - Intronic
1045036232 8:98178515-98178537 CACAGGTGTCCCAGAGATGGGGG - Intergenic
1047182811 8:122605552-122605574 GGCAGGTGACCCAAAAGTGGAGG + Intergenic
1048271041 8:133028230-133028252 CTCAGGTAACCCAGGAAAGCAGG - Intronic
1048583988 8:135755785-135755807 CTCAGGTTACCCAGAGAAGCAGG - Intergenic
1050320871 9:4450603-4450625 GTCAGGTTACCCACAAAGGGAGG + Intergenic
1050811155 9:9749388-9749410 CTCAGGAGACAGACAAATGGAGG - Intronic
1056459067 9:86791746-86791768 CTCAGAAGACCCAGTCATGGGGG + Intergenic
1060237436 9:121875281-121875303 CTGAGGTGTCCCAGAGGTGGTGG - Intronic
1060388607 9:123258337-123258359 GTAAGGAGAACCAGAAATGGAGG + Intronic
1060422088 9:123476500-123476522 ATCAGGTGACCAACAAATGTTGG - Intronic
1060523278 9:124306463-124306485 CTTAGCTGAGCCAGTAATGGTGG + Intronic
1061070457 9:128306967-128306989 CTCAGGTGGGCCAGGTATGGTGG + Intergenic
1061291588 9:129653530-129653552 ATCAGATGGCCCAGAAATGCAGG - Intergenic
1061338772 9:129961964-129961986 CTCTGGGGACCCAGACAGGGTGG - Intronic
1061806414 9:133139908-133139930 CTCAGGGGACCCAGACAAGTGGG - Intronic
1061859623 9:133461208-133461230 CCAAGGTGACCCTGAAAAGGTGG - Intronic
1203459861 Un_GL000220v1:24951-24973 GTCAGGTTACCTACAAATGGAGG - Intergenic
1186728426 X:12382283-12382305 ATGGGGTGACCCAGAAATAGAGG + Intronic
1188146060 X:26615228-26615250 TTAAGATTACCCAGAAATGGTGG - Intergenic
1190976202 X:55403951-55403973 CACAGGTTACACAGCAATGGAGG - Intergenic
1193789394 X:85800183-85800205 CTCAGGTAGCACAGAAATGAGGG + Intergenic
1193918238 X:87393992-87394014 CTCTTCTGAACCAGAAATGGAGG + Intergenic
1195105080 X:101595865-101595887 CTCAGGTGACCAAGATCTGTGGG + Intergenic
1199696418 X:150345811-150345833 CTCAGATGAAGCTGAAATGGGGG - Intergenic
1201405241 Y:13643211-13643233 CTAAGGTGACACAGAAAGGAGGG + Intergenic
1202034579 Y:20619224-20619246 GTCAGGTTACCCACAAAGGGAGG - Intergenic