ID: 1128997954

View in Genome Browser
Species Human (GRCh38)
Location 15:72310519-72310541
Sequence CTCTGGCTATGGTGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128997954_1128997958 20 Left 1128997954 15:72310519-72310541 CCTTCTTCACACCATAGCCAGAG 0: 1
1: 1
2: 0
3: 29
4: 306
Right 1128997958 15:72310562-72310584 TGAGACAGCGTCGACCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 87
1128997954_1128997957 19 Left 1128997954 15:72310519-72310541 CCTTCTTCACACCATAGCCAGAG 0: 1
1: 1
2: 0
3: 29
4: 306
Right 1128997957 15:72310561-72310583 TTGAGACAGCGTCGACCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128997954 Original CRISPR CTCTGGCTATGGTGTGAAGA AGG (reversed) Intronic
900711145 1:4115171-4115193 CTCTAGCTCTGGTTTGCAGAAGG - Intergenic
902335549 1:15752321-15752343 TTCTGGCTACTGTGAGAAGAGGG + Intergenic
902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG + Intronic
902794021 1:18788477-18788499 TTCTGTGTATGGTGTGAAGGAGG - Intergenic
903559241 1:24215652-24215674 CTCTGGCTGCTGTGTGCAGAAGG + Intergenic
904414569 1:30350336-30350358 CTCTGTTTCTGGTTTGAAGATGG + Intergenic
904908846 1:33919027-33919049 CACTGGCTATGGTATAAAGGAGG + Intronic
905998186 1:42400366-42400388 CTTTGGCTATACTGTGGAGAAGG + Intronic
906727568 1:48055110-48055132 TTCTGGCAAAGGTGTGGAGATGG + Intergenic
907358083 1:53892806-53892828 CTCTGGCTGAGGTGAGAGGATGG + Intronic
907592340 1:55686971-55686993 CTCTGGCTGTAGCATGAAGATGG - Intergenic
907650960 1:56294346-56294368 TTCTGGCTATGGTAAGAAAAAGG - Intergenic
908433839 1:64085483-64085505 CTCTGGCCATGTTGGGAATATGG - Intronic
909415562 1:75402270-75402292 CTATGGCTTTGGGGTAAAGAAGG + Intronic
910001884 1:82351281-82351303 TTCTTGTTATCGTGTGAAGAAGG - Intergenic
911659830 1:100488961-100488983 CTCTGGCTATGGTGTCATATAGG + Intronic
911780490 1:101869825-101869847 CTCTTGCTGCCGTGTGAAGAAGG + Intronic
911856365 1:102882136-102882158 CCTTGGCTATGGAGTGAAGATGG - Intronic
912954883 1:114148401-114148423 CTCTGGCTTTGGGGTGAGTAGGG - Intronic
915115203 1:153594118-153594140 TTCTGGATATGTTTTGAAGATGG + Intergenic
915980186 1:160415560-160415582 CTGTGGCTGTTGTGTGCAGATGG + Intronic
916409629 1:164533151-164533173 CACTGGCTATCGTGTAGAGAAGG - Intergenic
917402036 1:174660454-174660476 TTCTGGCTATGTTTTGAAGGTGG - Intronic
921366981 1:214383523-214383545 CTCTGGCCATGGCGGGAGGAAGG + Exonic
922431280 1:225556851-225556873 CTGTGCCTATGGTGTGAGGTAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923428170 1:233892457-233892479 TTCTTGCCATCGTGTGAAGAAGG + Intergenic
923833231 1:237580859-237580881 CTCTCTCCATGGTGTGTAGATGG - Intronic
1062811866 10:472627-472649 CTCTGGCTTTGCTGTGGGGATGG - Intronic
1063462638 10:6224243-6224265 CTAGGGCTATCGTGTGATGATGG - Intronic
1064776731 10:18787185-18787207 GTCTGGCTCTGGTGTTAAGAAGG + Intergenic
1065138805 10:22700614-22700636 CCCTTGCTATGGTGTGCAGGTGG + Intronic
1065513227 10:26500311-26500333 CTGTGACTTTGGGGTGAAGACGG - Intronic
1066231233 10:33435781-33435803 CTCTGGCTACTGTGTGGAGAAGG - Intergenic
1068221417 10:54050998-54051020 CTCCTGCTATCATGTGAAGAAGG + Intronic
1068381931 10:56265433-56265455 CTCTTGCCATGATGTGAAGAAGG - Intergenic
1070966204 10:80532827-80532849 CTCTGGCACTGGTGTGGAGAGGG - Exonic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1072449764 10:95530716-95530738 CTCTGGCTAAGCTGGGAGGAGGG - Intronic
1073302888 10:102481624-102481646 GCCTGCCTTTGGTGTGAAGAGGG + Intronic
1074250127 10:111736687-111736709 TCCTGGCTATGGTTTGGAGAAGG + Intergenic
1076257598 10:129040593-129040615 CTCTGGCTATGGTTGGATCATGG - Intergenic
1076378690 10:130010497-130010519 TTCAGGCTATGGTGGGAAGGGGG - Intergenic
1078480154 11:11668524-11668546 GGCTGGCTATAGTGTGGAGATGG + Intergenic
1080124095 11:28710950-28710972 CTCTGGCTGCTGTGTGAGGAAGG + Intergenic
1080561185 11:33464661-33464683 CACTGGCTGTGGTATGGAGAGGG - Intergenic
1080697904 11:34619215-34619237 CTCAGGCAATGGTGTAAAGAAGG + Intergenic
1085304219 11:75476087-75476109 CTGAGGCTAAGGTGAGAAGAAGG - Intronic
1085376051 11:76061638-76061660 CGCTGGCTCAGGTGTGAAGCTGG - Intronic
1087552712 11:99672392-99672414 TGCTGGCTATAGTGTGATGATGG + Intronic
1088763890 11:112958405-112958427 ACCTGGGTATGTTGTGAAGATGG - Intergenic
1089001951 11:115059564-115059586 CTCTTACTATGCTGGGAAGATGG - Intergenic
1089018763 11:115189369-115189391 GTCTGGCTATTGTGCCAAGAGGG + Intronic
1090400178 11:126443867-126443889 GTCAGGCTATGGTGGGAACAGGG + Intronic
1091725149 12:2841158-2841180 CTCTTGCTATGGAGAGAATAGGG + Intronic
1092993331 12:13924480-13924502 CTCTGGCTTTTGGGAGAAGAAGG + Intronic
1093387552 12:18577060-18577082 TTCTGGGACTGGTGTGAAGAAGG + Intronic
1094194116 12:27728098-27728120 AACTGGATATGGTGTGAAGCTGG + Intronic
1095561015 12:43565012-43565034 TTCTGGGTATGCTGTGAAGTAGG - Intergenic
1097492721 12:60290826-60290848 CACTGGCTAGTGTGAGAAGAGGG + Intergenic
1098981507 12:76961689-76961711 GTTTGGCTATGATGTGAAGATGG + Intergenic
1099455547 12:82858392-82858414 CTTTGACTTTGGCGTGAAGACGG + Intronic
1100428605 12:94510174-94510196 CTCTGTGCATGGCGTGAAGAAGG + Intergenic
1100650005 12:96575749-96575771 ATTTGCCTATGGTGTGAAGTAGG + Intronic
1101858639 12:108464624-108464646 CACTGGCTGTGGTGTGTTGATGG - Intergenic
1102620321 12:114189392-114189414 GTCTGGCAGAGGTGTGAAGATGG + Intergenic
1103708628 12:122895148-122895170 CCCTGGCTATGGTATGACCATGG + Intronic
1104509494 12:129364294-129364316 CTCTGGGTATAGTGTGCAGATGG + Intronic
1104646483 12:130501317-130501339 ATCTGGCTTTGGTTTGTAGAGGG - Intronic
1106360949 13:29029972-29029994 CTCTGGCTATGGTTTGGATATGG - Intronic
1106437742 13:29738833-29738855 CTCTCTCTTTGGTGTGCAGAAGG + Intergenic
1106719659 13:32425442-32425464 TCCTGGCTCTGGAGTGAAGAAGG - Intronic
1108080846 13:46733376-46733398 CCCTGGCTTTGGTGGGAAGGAGG + Intronic
1109095426 13:58107861-58107883 GCCTGGGTATGGTGTGGAGAGGG + Intergenic
1110346431 13:74453124-74453146 CTCCTGCTGAGGTGTGAAGAAGG - Intergenic
1110835847 13:80081988-80082010 CTCTGGCTTTGGTATGAACCAGG - Intergenic
1111316045 13:86561140-86561162 CTCTGGCTATGGTGTCTGAATGG + Intergenic
1111580449 13:90215759-90215781 CTCTGGCCTTGGTAAGAAGATGG + Intergenic
1112205047 13:97316359-97316381 CTCTGGCTACTGTGTGAGAATGG - Intronic
1112367685 13:98769699-98769721 CTCTTGCTACCATGTGAAGAAGG - Intergenic
1112478523 13:99753340-99753362 GACTGGCTGTGGTGTGGAGAAGG + Intronic
1113627450 13:111857490-111857512 CTCTGGCTGTGCTGTGGTGAAGG + Intergenic
1115265103 14:31492781-31492803 CTCTGGCGAGGGTGTGAATCCGG + Intronic
1115953129 14:38744368-38744390 CTCTTGCCATCTTGTGAAGAAGG - Intergenic
1117906160 14:60589705-60589727 CTCTATGTATGGTGTGAAGCAGG - Intergenic
1119471697 14:74904427-74904449 TTCGGGCCATGGTGGGAAGAGGG - Exonic
1120092454 14:80348558-80348580 CTCTTGCCATGATATGAAGAAGG - Intronic
1120758286 14:88264438-88264460 GGCTGGCTGTTGTGTGAAGAAGG + Intronic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1122635852 14:103129339-103129361 CTCTGGCTGCTGGGTGAAGAAGG + Intronic
1123190306 14:106563163-106563185 CTCTGGACCTGGTGTGAGGAGGG - Intergenic
1123539337 15:21272427-21272449 CCCTGACTATGGAGTGAAAAAGG - Intergenic
1124075720 15:26442770-26442792 TTCAGGCTATGATGGGAAGAAGG - Intergenic
1124085239 15:26543499-26543521 CCTTGGCTATCTTGTGAAGATGG - Intergenic
1126627601 15:50699836-50699858 CACTGGCTATGATGTGGAAAGGG + Intergenic
1126769105 15:52037322-52037344 CTCTGGTGAGGGTCTGAAGAAGG - Intronic
1127808955 15:62546662-62546684 CACTGGCCATGGTGCCAAGATGG - Intronic
1127972802 15:63974995-63975017 TTCAGGCCATGGTGGGAAGAGGG - Intronic
1128997954 15:72310519-72310541 CTCTGGCTATGGTGTGAAGAAGG - Intronic
1129066759 15:72911636-72911658 GGCTGGCTCTGGTGTGGAGATGG - Intergenic
1129126556 15:73446876-73446898 CTCTGGCTGTGGTGTGAAGATGG + Intronic
1131166118 15:90143381-90143403 CCCTGGCTGTGGTGTGATAAAGG - Intergenic
1131298289 15:91171902-91171924 TTCTGCAGATGGTGTGAAGAGGG - Intronic
1131880135 15:96853522-96853544 CTCTGGCTATTGTGCGCAGGAGG + Intergenic
1131965926 15:97842271-97842293 CTCTTGCTACGGTCTGAAGATGG - Intergenic
1132745563 16:1434794-1434816 CTCCGGCTGTGGAGTGAGGAGGG - Exonic
1133000063 16:2845781-2845803 CTCAGGCCATGATGGGAAGAGGG + Intergenic
1133101423 16:3482396-3482418 CTCTGGCTGTCGTGGGAAGTCGG + Intronic
1133597325 16:7305052-7305074 CACTGGCAATGCTGTGAAGAAGG + Intronic
1134234528 16:12455084-12455106 CTCTGGCTGTGGTGTGGAAAAGG + Intronic
1134749890 16:16617625-16617647 CTCTGGCTGCTGTGTGGAGAAGG + Intergenic
1134995586 16:18735990-18736012 CTCTGGCTGCTGTGTGGAGAAGG - Intergenic
1135146894 16:19970430-19970452 CTCCTGCTATCTTGTGAAGAAGG + Intergenic
1136143608 16:28302452-28302474 CTCTGGGCAGGGTGTGAAGGGGG + Intronic
1137672424 16:50286845-50286867 CTCTGGGTATGGTGTGAGGTAGG - Intronic
1138632312 16:58307673-58307695 CTCAGGCCATGATGGGAAGAGGG + Intronic
1140719016 16:77753660-77753682 CTCTGGATGTTGGGTGAAGAAGG - Intergenic
1141186485 16:81791212-81791234 CACTGGATGTGGTGTGAGGAGGG + Intronic
1141915802 16:87096064-87096086 CTCTGGCTATGATTTGCAGCAGG + Intronic
1144363181 17:14516213-14516235 CTCTGTCTCTGATGTGAACAGGG - Intergenic
1145842057 17:28003518-28003540 CTCTGGCTGCTATGTGAAGAAGG + Intergenic
1148694265 17:49549623-49549645 CTCTGGCTACTGTGAGAAGTAGG + Intergenic
1148967022 17:51444271-51444293 TTCTGTATATGGTGTGAGGAAGG - Intergenic
1149328301 17:55555735-55555757 CTCTGAAGATGGTGGGAAGATGG - Intergenic
1150505216 17:65691844-65691866 CTCTGACAGTGGTGTGAGGATGG - Intronic
1155045630 18:22100655-22100677 CTCTGGCTGCTGTGTGGAGATGG + Intergenic
1155380607 18:25218221-25218243 TTCTGGCAGTGGTGTGGAGATGG + Intronic
1155928586 18:31684262-31684284 CGCTGGCTGTGGTGTGACCAGGG + Intronic
1156526125 18:37768950-37768972 TTCTGGCTACAGTGTGGAGAAGG + Intergenic
1156818596 18:41342711-41342733 CTTTAGCAATGGTATGAAGATGG - Intergenic
1157729491 18:49991158-49991180 CCCTGGCTGTGGTGTAAAGCAGG + Intronic
1157942026 18:51939675-51939697 CTGTGGCTATGGTTTGGACATGG + Intergenic
1158012405 18:52744037-52744059 CTTTAGCTATGGTCTTAAGAAGG + Intronic
1158068480 18:53441772-53441794 CTCTGGCTGTTGTGTGGAGAGGG - Intronic
1158533474 18:58284775-58284797 CTATGGCCATGGTGTAAAAATGG - Intronic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1161562655 19:4981923-4981945 TTCTGGCCATGGTGTGAGGCAGG - Intronic
1163060872 19:14760718-14760740 TTCAGGCTATGGTGGGAAGTGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1165104389 19:33460489-33460511 CTCTGAAGATGGTGGGAAGATGG - Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1167776305 19:51559909-51559931 CTCTGGACATGGTGAGAAGATGG - Intergenic
1168029313 19:53666955-53666977 CTCTGGCAATGGTGTGACCCAGG - Intergenic
1168029650 19:53669439-53669461 CTCTGGCAATGGTGTGACCCAGG - Intergenic
925851835 2:8089316-8089338 CTCTGGCTATAGTGTAAAAGAGG - Intergenic
925952068 2:8924167-8924189 CTCTGAATCTTGTGTGAAGATGG - Intronic
926355996 2:12041160-12041182 CTCTGGCCATGTTGTGAATAGGG - Intergenic
926484434 2:13437563-13437585 CTCTTGCTGTCTTGTGAAGAAGG - Intergenic
929545963 2:42855404-42855426 CTCTGGGTAGGGTGTGAATGGGG - Intergenic
930582047 2:53223593-53223615 CTTTGCCTATAGTGTGATGAAGG + Intergenic
930614399 2:53578589-53578611 CTCTGGTTACAGTGTGAAGAAGG + Intronic
930914921 2:56674576-56674598 CTCAGTCTATGGGGTGAAGGTGG - Intergenic
931132316 2:59350398-59350420 TTCTGTGTATGGTGTAAAGAAGG - Intergenic
931162099 2:59703679-59703701 TTCTTGCTGTGTTGTGAAGAAGG - Intergenic
931228416 2:60353263-60353285 CACCGGCTCTGGTGTGGAGAGGG + Intergenic
931428630 2:62192863-62192885 CTCTGACTGCAGTGTGAAGAAGG - Intergenic
932015316 2:68020565-68020587 ATATGGCTATGGTTTGAATATGG + Intergenic
933651248 2:84852089-84852111 CTCTGGTTATGTTGTGGGGAGGG + Intronic
937042369 2:118832621-118832643 CATTGGCTAAGGTGGGAAGAAGG + Intergenic
937437209 2:121890325-121890347 AGCTGGCTATGATGTGAAGCGGG + Intergenic
937492949 2:122388713-122388735 ATCTGGCTCTGGGGTGATGAGGG + Intergenic
937916967 2:127103998-127104020 CTGTGGCCTTGGTGTGAGGAGGG - Intronic
938045465 2:128115150-128115172 CTCTGGCTATGGCGTGGAATTGG + Exonic
941396550 2:164980993-164981015 CCCTGACTATGGAGTGAAAAAGG - Intergenic
941855759 2:170228653-170228675 CACTAGCTATGGTGGGAAGCTGG + Intronic
941870363 2:170378234-170378256 CTCTGGCTATGGGGTTTGGAGGG - Intronic
942172738 2:173303651-173303673 TTCAGGCTATGATGTGAAGTAGG - Intergenic
942732248 2:179073318-179073340 CTCCTGCTGTGTTGTGAAGAAGG + Intergenic
943176776 2:184486011-184486033 CACTGGCATTGGAGTGAAGAAGG + Intergenic
943561897 2:189473678-189473700 CTCTGGATGTGGGGTGAAAATGG - Intronic
944700497 2:202241558-202241580 CTCCTGCTCTCGTGTGAAGAAGG + Intergenic
945109721 2:206350644-206350666 CTCTTGCTGTCTTGTGAAGAGGG - Intergenic
946223527 2:218249371-218249393 CACTGGCATTGGTGTGACGAGGG - Exonic
946402401 2:219475516-219475538 TTCTGGCCGTGCTGTGAAGATGG + Intronic
947611502 2:231527593-231527615 CTCAGGCTGTGGTGTGACCACGG - Intronic
948070136 2:235114208-235114230 CTCTGCCTAGGGTGGGAGGAAGG - Intergenic
1168767793 20:393748-393770 CTCTTGATATGATGTGGAGAGGG - Intronic
1168843931 20:929178-929200 TTCTGGCCATGATGGGAAGAGGG - Intergenic
1169038453 20:2472518-2472540 CTTTAGAGATGGTGTGAAGATGG - Intronic
1170728316 20:18948974-18948996 GTCTGGCCATGGTGGGAGGATGG + Intergenic
1171781080 20:29418458-29418480 CTCTGTAAAAGGTGTGAAGAGGG + Intergenic
1174301361 20:49584855-49584877 CTGTGGCTAGGGTGTGGACATGG + Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1177228367 21:18286701-18286723 ATCAGGCTAATGTGTGAAGATGG - Intronic
1177275041 21:18899652-18899674 TTCTGGCTATTGTCTGAAGGAGG + Intergenic
1177473587 21:21590481-21590503 TTCAGTGTATGGTGTGAAGAAGG - Intergenic
1178245777 21:30950668-30950690 CTCTGTGTATGGTGTGAGGTAGG - Intergenic
1178388109 21:32172926-32172948 TTTTGGCTATGGTGTGAGGTTGG - Intergenic
1178589726 21:33899094-33899116 CTCTGGCTGGGGTGGCAAGAGGG + Exonic
1179351214 21:40612713-40612735 CTCTGGCTGAAGTGTGGAGATGG + Intronic
1179608986 21:42536928-42536950 CTCTGGCTGTGGTGTGACTATGG - Intronic
1179877018 21:44273763-44273785 TTCTGTGTATGGTGTGAAGTAGG - Intergenic
1180909665 22:19440546-19440568 CTCTGGCTGCTGTGTGGAGAAGG - Intronic
1181009043 22:20029527-20029549 CCTTGGCTGCGGTGTGAAGAGGG + Intronic
1181112790 22:20611710-20611732 CTCTGGCTATGCTGGGCCGAAGG - Intergenic
1183758166 22:39790221-39790243 CTTTGGCTTTTATGTGAAGAGGG + Intronic
1184147300 22:42619190-42619212 CTCTGGCTAGAGTGGGAAGAGGG - Exonic
951738544 3:25895200-25895222 CTGTGGCTATGTTTTGAAGGTGG - Intergenic
952615749 3:35271519-35271541 CAATTGCTATGGTGGGAAGAAGG + Intergenic
953320009 3:41962928-41962950 CTCAGGCAATGATGGGAAGATGG + Intergenic
953781647 3:45876721-45876743 CACAGGCTTTGGTGTCAAGACGG - Intronic
954220710 3:49151952-49151974 GTCTGCCTATGGTGGGAAAAGGG + Intergenic
954618791 3:51984148-51984170 GCCTGACTATGGTGAGAAGACGG + Exonic
955672164 3:61412959-61412981 TTCTGGCTATGTTGTGGAGAAGG + Intergenic
955732020 3:61997256-61997278 CTCTGGCTACTCTGTGGAGAAGG - Intronic
956289503 3:67646851-67646873 TTCTGGATATAGTGTGGAGAGGG - Intronic
956556411 3:70528227-70528249 ATCTGGGTAGGGGGTGAAGAAGG - Intergenic
956693083 3:71895553-71895575 TTCTGGCCATCATGTGAAGAAGG + Intergenic
957102264 3:75842889-75842911 CTCTAGCTATGTTTTCAAGATGG - Intergenic
958447112 3:94229394-94229416 CTCTGGATAGGGTGTGTACAAGG + Intergenic
958868799 3:99532802-99532824 CAGTGGCTATGCTGTGTAGAGGG - Intergenic
961007615 3:123415345-123415367 CTCTGGCTCTGGCGTGGAGGTGG - Intronic
962982654 3:140504778-140504800 CTCTGGCTCTGGAGAGAAGGTGG - Intronic
965394384 3:168143980-168144002 TTCTGGCTACCATGTGAAGAAGG - Intergenic
966610978 3:181867797-181867819 CTCTGGCTATAATATGCAGAAGG - Intergenic
967551857 3:190805093-190805115 CACTGCTTATGGTGGGAAGAAGG + Intergenic
968793843 4:2688677-2688699 CTCTGGCTGTAGTGGGGAGAAGG + Intronic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
972103561 4:35452901-35452923 CTCTGGCTGCCTTGTGAAGAAGG - Intergenic
973877939 4:55240509-55240531 TTTTGGGAATGGTGTGAAGAAGG - Intergenic
974214637 4:58829058-58829080 TTCTTGCCATTGTGTGAAGAAGG - Intergenic
975169710 4:71219326-71219348 CTCTGCCTATGCTCTGAAGATGG + Intronic
975672151 4:76791254-76791276 TTCTGGCAAGGATGTGAAGAAGG + Intergenic
976803329 4:89018328-89018350 CTCTCTCTTTGGTGTGCAGATGG - Intronic
977528298 4:98170753-98170775 CTCAGGCTGCAGTGTGAAGATGG - Intergenic
980908703 4:138974579-138974601 TTCAGGCTATGGTGGGAAGCGGG + Intergenic
982082729 4:151806277-151806299 CTTTCACTATGGTGTGAGGAAGG + Intergenic
982294741 4:153815961-153815983 TTTTGTCTATGGTGTGAGGAAGG + Intergenic
982314084 4:154013605-154013627 TTTTGTGTATGGTGTGAAGAAGG + Intergenic
982647051 4:158037324-158037346 GTCTGGCCATGAGGTGAAGAGGG - Intergenic
982865250 4:160501968-160501990 CTCTGGCTGCTGTGGGAAGAAGG + Intergenic
983259293 4:165438126-165438148 CTCTGGCGATTGTGTGGAGGAGG + Intronic
983949920 4:173627622-173627644 CAGTGGCTGTGTTGTGAAGATGG + Intergenic
984322043 4:178208413-178208435 CACAGGCTAAGGTGAGAAGAAGG - Intergenic
986557385 5:9025381-9025403 GCCTGGGTATGGGGTGAAGAGGG + Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987013309 5:13790659-13790681 TTCTTGCTATCTTGTGAAGAAGG + Intronic
987470793 5:18325057-18325079 CTCCTGCCATGATGTGAAGAAGG + Intergenic
987546021 5:19310973-19310995 CTCTTGCTGTCCTGTGAAGAAGG - Intergenic
987593415 5:19963589-19963611 CTCCTGCTATCATGTGAAGAAGG + Intronic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
988990796 5:36668849-36668871 CTCTCCCTATGGTGTGAGAAGGG + Intronic
989300165 5:39881728-39881750 CTCATGCCATCGTGTGAAGAAGG - Intergenic
991508368 5:67350088-67350110 AACTGGCCATGGTGTGAGGAGGG - Intergenic
992193023 5:74312668-74312690 CTCAGGCCATGATGGGAAGAGGG + Intergenic
992810709 5:80385624-80385646 CCCTGGCTATAGTGAGAAGCTGG + Intergenic
994198504 5:96945707-96945729 CTCAGGCTATGATGGGAAGCGGG - Intronic
994296498 5:98095334-98095356 CTCTCACTACGATGTGAAGAAGG + Intergenic
994383439 5:99099330-99099352 CTCTCGCTGCGTTGTGAAGAAGG + Intergenic
994614244 5:102083384-102083406 TTTTGTATATGGTGTGAAGAAGG - Intergenic
995406867 5:111807868-111807890 CTCTGAATATCATGTGAAGATGG + Intronic
995655832 5:114425167-114425189 CCAAGGCCATGGTGTGAAGAAGG + Intronic
996620988 5:125502376-125502398 TTCTGGATATGGTGTGATAAAGG + Intergenic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
999649146 5:153748564-153748586 CTCTGGCTCTTGTGTGAACATGG + Intronic
1000279381 5:159768963-159768985 TTCTGACTATTGTGTGAAGTGGG + Intergenic
1002361996 5:178679651-178679673 CTCTACCTATGATGTGAAGGTGG - Intergenic
1003674809 6:8193206-8193228 CTCAGGCCATGATGGGAAGATGG + Intergenic
1004266797 6:14155248-14155270 CTCTGTCTTTGATGGGAAGAGGG - Intergenic
1004329390 6:14707900-14707922 CTCTGGCTATTCGGTGAAGGAGG - Intergenic
1004825552 6:19416787-19416809 CTCTGTGTATGGTGTGAGGAAGG + Intergenic
1005218156 6:23555603-23555625 CTCTTGCTCTCATGTGAAGAAGG - Intergenic
1006203517 6:32318731-32318753 CTGGGGCTATGGTGTGGAGAGGG + Intronic
1006318746 6:33306620-33306642 GTTTGGCTACAGTGTGAAGAAGG - Intronic
1009539810 6:64940097-64940119 CTCTGGATAAGTTGTCAAGAAGG - Intronic
1010831389 6:80534769-80534791 CTCTGTCTTTGGTTTGCAGATGG + Intergenic
1011659138 6:89579039-89579061 CTCTGGAAATGGTGTGCAGGAGG - Intronic
1012529945 6:100223194-100223216 CTATGGCTACCATGTGAAGAAGG + Intergenic
1012605001 6:101146782-101146804 CTCTTGCTATGCTGTTAAGAGGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013995305 6:116301533-116301555 CTCTGGCTGTAGTGTGGAGAAGG - Intronic
1014727828 6:124994019-124994041 CTCTGGCTGGAGTGTGGAGAAGG + Intronic
1015616359 6:135079357-135079379 CTCTGGCTGCCTTGTGAAGAAGG + Intronic
1015834662 6:137407334-137407356 TTTTGTATATGGTGTGAAGAAGG + Intergenic
1015952024 6:138562815-138562837 CTCTGGTTATGGCGTGCAGAAGG - Intronic
1018259048 6:161951385-161951407 CTCTGGCTAAAGAGAGAAGAAGG - Intronic
1018292815 6:162310334-162310356 CTCTGGCTATGGTGGGGAACTGG - Intronic
1019272090 7:156133-156155 CACTGGCTACGGCGGGAAGAGGG - Intergenic
1020603211 7:10302781-10302803 CTCTGGGTATGATGTTAACATGG + Intergenic
1022852878 7:34283169-34283191 CTCTTGCTGCGTTGTGAAGAAGG - Intergenic
1022892140 7:34712365-34712387 CTTTGGCTACAGTGTGAAGAAGG - Intronic
1023630351 7:42157458-42157480 CTGGGGCTGTGGTGTGAGGAAGG - Intronic
1024113913 7:46174077-46174099 CCCTGGCTCTGGAGTGAGGATGG + Intergenic
1024196611 7:47065251-47065273 CTCTGGCCATGGAATGCAGATGG - Intergenic
1024462957 7:49678987-49679009 CTCTGAGAATGGTGTCAAGATGG + Intergenic
1024886583 7:54149014-54149036 ATCTGCCTATGGTGCTAAGAAGG + Intergenic
1026612901 7:71876106-71876128 GCCTTGCTATGGTGTGAAAATGG + Intronic
1031082995 7:117276368-117276390 CTCTGAGCTTGGTGTGAAGAAGG - Intergenic
1032093218 7:128922571-128922593 CAATGGCTATGATGTGAATAAGG + Intergenic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1033720863 7:144058549-144058571 TTCTGGCCACCGTGTGAAGAAGG - Intergenic
1034500065 7:151444443-151444465 CTCTGGCCCTGCTGTGATGAGGG - Intergenic
1036583865 8:10104764-10104786 TTCAGGCTATGATGTGAAGGGGG - Intronic
1036913325 8:12779021-12779043 CTCTGTCTATAGTGAGAGGAGGG - Intergenic
1037900165 8:22683557-22683579 CTCTGTCTTTGGTGAGAACAGGG + Intergenic
1039572930 8:38601614-38601636 GTCTGGCTTTGGAGTGACGAGGG + Intergenic
1039739212 8:40365382-40365404 TTCTGTTTATGGTGTGAGGAAGG + Intergenic
1040408003 8:47127678-47127700 TTCTGGCTATGGTGTAAAATAGG - Intergenic
1041033335 8:53760759-53760781 TTCAGGCTATGATGGGAAGAGGG + Intronic
1041662380 8:60412844-60412866 CTCTGGCTCTGGTCTGCTGATGG + Intergenic
1043919871 8:85969185-85969207 ATCAGCCTATGGTGTGATGAGGG + Intergenic
1045423557 8:102040802-102040824 GTCTGGCTCTGTTATGAAGATGG - Intronic
1046119890 8:109832508-109832530 TTCTGTGTATGGTGTAAAGAAGG - Intergenic
1046271413 8:111902364-111902386 TTCAAGCTGTGGTGTGAAGAAGG - Intergenic
1046925424 8:119781736-119781758 CTCAGGCTATGGTGCGATCATGG + Intronic
1048702455 8:137108176-137108198 TCCTGGATATGGTGTGAAGTTGG + Intergenic
1049378939 8:142302504-142302526 CCCTGGCTATGGTGTGAGCTGGG - Intronic
1049787874 8:144459752-144459774 CCCTGACTCTGGTGAGAAGAGGG - Intronic
1050119029 9:2289135-2289157 CTATGACTGTGGTGTGAGGAGGG + Intergenic
1051187320 9:14473981-14474003 CGCTGGACATGGTGTGAGGACGG + Intergenic
1052009281 9:23386796-23386818 TTCTGGCAATGGTGGGCAGATGG - Intergenic
1052245586 9:26330083-26330105 CTCTGGCCGAGGTGTGCAGAGGG - Intergenic
1053267492 9:36725902-36725924 CTGTGTCTCTGGTGTGAACAGGG + Intergenic
1053512916 9:38704695-38704717 CTCTTGCTATTCTGTGAGGAAGG - Intergenic
1056493338 9:87130113-87130135 CTTTGTATATGGTGTGAGGAAGG + Intergenic
1057002907 9:91529270-91529292 TTCTTGCTATGGTGGGAAAAGGG + Intergenic
1057067230 9:92066705-92066727 CTCTGGCTGTGATGTTAAAAAGG + Intronic
1058826167 9:108777875-108777897 TTCTAGCTACGGTGTGAACATGG + Intergenic
1059632484 9:116139516-116139538 CTCTGGCTATTGTTTAAAGAAGG - Intergenic
1059840344 9:118208534-118208556 GTGTGGCAATGGTGTGAACAGGG + Intergenic
1060084915 9:120689476-120689498 TTCTGGCTACAGTGTGAAAATGG + Intronic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1203790085 EBV:146621-146643 TTCTTGCTATGGGGTGAACAAGG - Intergenic
1191707156 X:64105352-64105374 CTCTGGCTCAGCTGGGAAGACGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1194087951 X:89552238-89552260 CTCTTGCTACCATGTGAAGACGG - Intergenic
1195600814 X:106745530-106745552 CTCCTGCTATGGTTTGAATATGG - Intronic
1196247917 X:113422505-113422527 CTCCGGCTGTCTTGTGAAGAAGG + Intergenic
1197887809 X:131236544-131236566 CTCTGGCTTGGGTGTGGAGTGGG - Intergenic
1200440669 Y:3208563-3208585 CTCTTGCTACCATGTGAAGACGG + Intergenic
1201584823 Y:15548863-15548885 CTTTGGCTGTGTTGGGAAGAGGG + Intergenic
1202189966 Y:22231540-22231562 TTCTGGCTATGGTTGGAAAAGGG + Intergenic