ID: 1128998399

View in Genome Browser
Species Human (GRCh38)
Location 15:72313603-72313625
Sequence ACGTGAGCATGGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128998399 Original CRISPR ACGTGAGCATGGAGGGAAGC TGG (reversed) Intronic
900005989 1:51770-51792 GCGGGAGCATGGCGGGAACCGGG + Intergenic
900569051 1:3349421-3349443 AAGTGGCCATGGCGGGAAGCAGG + Intronic
901002173 1:6154349-6154371 ACGTGGGCCTGGAGGGAGGGCGG - Intronic
901150341 1:7097119-7097141 ACGGGAGCAGGAAGGGAAGAGGG - Intronic
901624188 1:10614376-10614398 ACGTGAGCATGGCAGGAATGAGG + Intronic
901843310 1:11966743-11966765 ACATGGGCATGGAGGGAGGGAGG - Intronic
901876922 1:12172143-12172165 AAGCGGGCAAGGAGGGAAGCTGG + Intronic
902318933 1:15646052-15646074 AGGTGAGCATGGAGGGAGACAGG - Intronic
902623216 1:17662471-17662493 GCGTGAGCACCAAGGGAAGCAGG - Intronic
904206185 1:28856760-28856782 CAGAGAGCATGGAGGGATGCTGG + Intronic
905117497 1:35654967-35654989 AGGTGAGAATGGAGGGGAACAGG - Intergenic
905230862 1:36514309-36514331 ACCTGAGGTGGGAGGGAAGCTGG + Intergenic
905275376 1:36814209-36814231 ATCTTAGCATGGAGGGAGGCAGG + Intronic
906056021 1:42917358-42917380 AGGTGAGCATGGAGAGTCGCGGG - Intergenic
910274271 1:85431546-85431568 AGGTGAGGAAGGAGGGAAGAAGG - Intronic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
913528681 1:119716870-119716892 TGGTGAGCATGGAGGGAAACAGG - Intronic
914938765 1:152003734-152003756 ATGTGAGAATGGGGTGAAGCTGG + Intergenic
915461051 1:156070739-156070761 AGGAGAGCATGGAGGGGAGGGGG + Intergenic
915607665 1:156963318-156963340 GGATGAGCATGGTGGGAAGCCGG + Intronic
915856197 1:159389003-159389025 AGGTGAGCTTGAAGGGAAGATGG + Intergenic
917278699 1:173358138-173358160 ACGTGATGATGGAAGGAAGTTGG + Intergenic
917673557 1:177298289-177298311 ACTAGAGCAGGGAGGGAAGGAGG + Intergenic
921090441 1:211836854-211836876 ACGTGGGGAGGGAGGGGAGCAGG - Intergenic
921354233 1:214270722-214270744 ACTTGAGAATGGAGGGTAGGAGG - Intergenic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
1062941997 10:1429121-1429143 TTGTTATCATGGAGGGAAGCCGG + Intronic
1064857976 10:19792955-19792977 ACGAGAGTATGGAGGGAGGATGG - Intergenic
1064896212 10:20240075-20240097 ACTTGAGGATAGAGGGAGGCAGG - Intronic
1066462696 10:35625441-35625463 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1069052290 10:63808851-63808873 ACTTGAGGATGGAGGGTGGCAGG - Intergenic
1070824395 10:79382279-79382301 ACGCAAGCATGTAGGGAGGCTGG - Intergenic
1072137475 10:92560903-92560925 AGGTGAGGATGGAGTGAAGGTGG - Intronic
1072665469 10:97389482-97389504 ATGTGAGCACCGAGGGAAGGGGG + Intronic
1073117150 10:101097620-101097642 ACATGAGACTGGAGAGAAGCTGG - Intronic
1073787306 10:106903958-106903980 AAGTGAGGATTGAGGGAAGAAGG - Intronic
1074723680 10:116285792-116285814 AAGTGAGCACGGAGGGGTGCAGG - Intergenic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1077143039 11:1033268-1033290 ACGAGAGCAGGGAAGGAAGCTGG - Intronic
1077242943 11:1520565-1520587 CCGTGAGGATGGAGGGAGCCCGG - Intergenic
1077452298 11:2655689-2655711 AGGAGAGCATGGAGGGGAGCTGG - Intronic
1077473625 11:2776334-2776356 ACCTGAGCAGGGACGGAGGCGGG - Intronic
1077555274 11:3222946-3222968 ACGTGAGGTTGGAGGCCAGCAGG + Intergenic
1080232507 11:30033806-30033828 ACCTGAGTATGGAGGGTAGAAGG + Intergenic
1081804176 11:45881288-45881310 ACGTGAGGAGGGAGGGAAGGAGG - Exonic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1084182064 11:67451791-67451813 ACGAGAGCACGGAGCGCAGCAGG + Exonic
1084264833 11:67999498-67999520 AGGTGAGCCTGGTGGGCAGCAGG - Exonic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1084587083 11:70068589-70068611 ACGTGAGCCAGGAGGGAAGGAGG + Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085258376 11:75190256-75190278 ACATGAGCCTGGAGGGAATCAGG + Intronic
1085828377 11:79872766-79872788 ACGTGAGAATGGAGGGAGGCAGG + Intergenic
1086124243 11:83333596-83333618 AGGTGAGTATGGAGGGGAGTTGG - Intergenic
1088409270 11:109515309-109515331 ACTTGAGGGTGGAGGGAAGTAGG - Intergenic
1089034497 11:115372842-115372864 AGGTGAGCATGGATGAAAGAAGG + Intronic
1089202245 11:116731562-116731584 AGGTGAGCAGGGAGAGAAGATGG + Intergenic
1091490644 12:929743-929765 AGGTGAGCAGGTAGGGAAGTAGG - Intronic
1091783969 12:3231221-3231243 AGGGGAGAATGAAGGGAAGCGGG + Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1095473971 12:42566204-42566226 ACGAAAGAATGGAGGGAAGGGGG + Intronic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1096262827 12:50103745-50103767 ATGAGACCATGGTGGGAAGCTGG + Intergenic
1096311411 12:50524547-50524569 GCGGGAGGATGGAGGGAGGCAGG - Intronic
1097394155 12:59053589-59053611 ACATGAGGATGGATGGTAGCAGG - Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102237679 12:111304333-111304355 AAGTGAGCAGGGAGGGCAGAGGG + Intronic
1102992091 12:117322646-117322668 ACGGAAGGAGGGAGGGAAGCAGG - Intronic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1105045764 12:133002009-133002031 ACGTGAGAAGAAAGGGAAGCGGG - Intronic
1109166770 13:59044958-59044980 AAGTGAGCATGGTGGGTAACTGG + Intergenic
1110050887 13:70897712-70897734 ACTTGAGAATGGAGGGTAGGAGG - Intergenic
1110149591 13:72234763-72234785 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1112155554 13:96812987-96813009 ACGAGAGCATAGCAGGAAGCAGG - Intronic
1112507914 13:99985970-99985992 ACGTGGGCATGGAGATTAGCAGG - Exonic
1113296176 13:108961154-108961176 ACGTGAGCCTGGAGAGGAGGGGG + Intronic
1117802974 14:59464347-59464369 ACATGAGCAGGAAGGGCAGCAGG + Exonic
1118680432 14:68236053-68236075 ACTTGAGGGTGGAGGGAGGCAGG + Intronic
1119498079 14:75098084-75098106 AGGGGAGCAAGGATGGAAGCAGG + Intronic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1126789845 15:52211115-52211137 ACGTGATCATGAAGGGACCCAGG - Intronic
1127022856 15:54769422-54769444 ACTTGAGGGTGGAGGGAAGGAGG + Intergenic
1127709638 15:61583536-61583558 ACTTGAGGGTGGAGGGAAGAAGG + Intergenic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129892409 15:79080145-79080167 GCCTGAGCAAGGAGGGAAACAGG - Intronic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1132447526 15:101939153-101939175 GCGGGAGCATGGCGGGAACCGGG - Intergenic
1132652262 16:1026828-1026850 ACGTGAGCGTGTTCGGAAGCGGG + Intergenic
1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG + Intronic
1134384212 16:13756898-13756920 ACTTGAGGAGGGAGGGAAGCCGG - Intergenic
1134793720 16:17014725-17014747 ACTTGAGCAGGGAGGGAAGGAGG - Intergenic
1136627675 16:31472072-31472094 CCGTGACCATGTAAGGAAGCCGG - Exonic
1137858123 16:51817345-51817367 ACTTGAGGATGGAGGGAAGGAGG - Intergenic
1137944878 16:52724224-52724246 ACTTGAGCATGGAGGGTGGGAGG - Intergenic
1138606701 16:58094389-58094411 ACCTGCCCTTGGAGGGAAGCAGG - Intergenic
1138614766 16:58156688-58156710 AAGTGACTATGGAGGAAAGCAGG - Intergenic
1139473088 16:67188700-67188722 AGGTGAGCATGCAGGGACCCTGG - Exonic
1140245662 16:73245763-73245785 AGGTGAGCAGAGAGGGTAGCTGG + Intergenic
1141176150 16:81720580-81720602 CCGTGAGCACTGAGGGCAGCTGG - Intergenic
1142432631 16:90038283-90038305 ACGAGAGCATGCAGGAAACCTGG - Intronic
1142618502 17:1150747-1150769 ACGCGAGCAGGGAGGGACGAAGG + Intronic
1143167092 17:4902178-4902200 ACGCCAGGCTGGAGGGAAGCCGG - Exonic
1143375251 17:6463408-6463430 ACGAGTGCAGGGAGGGAGGCAGG + Intronic
1143706080 17:8698496-8698518 ACGTGAGGCTGGAGGTAAACAGG + Intergenic
1143801516 17:9386534-9386556 AAGTCAGGAGGGAGGGAAGCAGG + Intronic
1144567295 17:16370302-16370324 ACTTGAGGATGGAGGCAAGAAGG - Intergenic
1144705166 17:17363341-17363363 ACAGGAGCTTGGAGGGGAGCAGG - Intergenic
1145279636 17:21458027-21458049 AAGGGAGCATGGAGGGGAGATGG + Intergenic
1145398242 17:22512455-22512477 AAGGGAGCATGGAGGGGAGATGG - Intergenic
1146525120 17:33560678-33560700 ATGTGACCATGGAGGTTAGCAGG + Intronic
1146725891 17:35155427-35155449 GCGGGAGCATCGAGGGAAGGAGG + Exonic
1146826994 17:36031668-36031690 AGGGGAGCAAGAAGGGAAGCAGG - Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1148218600 17:45847375-45847397 ACCTGAGCATGGAGAGAAGATGG - Intergenic
1149062467 17:52438962-52438984 ACCTGAGCATGGAAGGTAGGAGG - Intergenic
1151530344 17:74700294-74700316 AAGTGAGGCTGGAGTGAAGCAGG - Intronic
1151893289 17:76963784-76963806 AGGGGAGCAGGGAGAGAAGCCGG - Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1152923847 17:83079002-83079024 CCGGGAGGAGGGAGGGAAGCCGG + Intergenic
1153862245 18:9224577-9224599 TGGTGAGCTTGGAGTGAAGCTGG + Intronic
1156067868 18:33166925-33166947 ACTTGAGGGTGGAGGGAGGCAGG - Intronic
1157966949 18:52218962-52218984 GAGTGACCATGCAGGGAAGCTGG - Intergenic
1158316046 18:56212344-56212366 GCATGAGCAAGGAGGGCAGCAGG - Intergenic
1158905882 18:62011280-62011302 ACCTGAGCTTGTAGAGAAGCAGG + Intergenic
1160130260 18:76218935-76218957 ACTGGAGCATGGGGGAAAGCAGG + Intergenic
1160133019 18:76246488-76246510 AGGAGAGAATGGAAGGAAGCAGG - Intergenic
1160637746 19:93376-93398 GCGGGAGCATGGCGGGAACCGGG + Intergenic
1161610865 19:5241791-5241813 ACCTGAGCAGGGAGGGAGACTGG + Intronic
1161872703 19:6882628-6882650 CCTTGAGCATGTAGGGATGCTGG - Intergenic
1162544486 19:11320447-11320469 GCGGGAGCATGGCTGGAAGCTGG + Intronic
1163106606 19:15126502-15126524 ATGTTAGCATTCAGGGAAGCTGG + Intergenic
1164863518 19:31582768-31582790 AGTTGAGCATGGAGGAAATCAGG + Intergenic
1166836523 19:45670863-45670885 ACCTGAGCATGGTGGGAACTGGG + Intronic
925449325 2:3954495-3954517 ACGTGAGGATGCAGGGAAGTGGG + Intergenic
926367903 2:12150424-12150446 AGGTGCGCATGGGGAGAAGCAGG - Intergenic
929603787 2:43221346-43221368 AGCTGAGCATGGAGGGGAGGGGG - Intergenic
930919856 2:56739405-56739427 AAGAGAGAAGGGAGGGAAGCAGG - Intergenic
931014673 2:57962567-57962589 ACTTGAGGATGGAGGGAGGGAGG - Intronic
931139874 2:59445602-59445624 ACAAGAGAATTGAGGGAAGCTGG - Intergenic
932333749 2:70917496-70917518 TGGTGAGGATGCAGGGAAGCTGG - Intronic
932357362 2:71077635-71077657 AGGTGAGCCTGGGGGGAGGCTGG + Exonic
936327958 2:111521965-111521987 ACGAGACCCTGGAGGGAAGCTGG + Intergenic
936893531 2:117400516-117400538 AAGTCAGCAAGGATGGAAGCAGG - Intergenic
937228625 2:120384099-120384121 ACGGCTGCTTGGAGGGAAGCAGG - Intergenic
939512421 2:143123493-143123515 ACGGGAGCCTGGAGGGAAGGAGG - Intronic
940801461 2:158137328-158137350 AGGTGAGCATGGAAGGAATCTGG - Intergenic
941378916 2:164766754-164766776 CCATGTGCATGGAGGAAAGCAGG - Intronic
941619549 2:167760963-167760985 ATGTGAGCCTGGAGTGCAGCAGG + Intergenic
941696401 2:168557079-168557101 ACCTGAGCATGGAGAGATCCTGG + Intronic
941994874 2:171592867-171592889 ACAGTAGCATGCAGGGAAGCTGG - Intergenic
943081941 2:183266612-183266634 ACTAGAGCAAGGAGGGAAGTGGG - Intergenic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
947309820 2:228789050-228789072 ACTTTAGCAAGGAGGGAAACAGG + Intergenic
949033731 2:241807368-241807390 GCGTGAGGGGGGAGGGAAGCTGG - Intergenic
1168802527 20:652776-652798 ACTTGAGCAAGGAGGGAATTGGG - Intronic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169979074 20:11363409-11363431 AGGAGAGAATGGAAGGAAGCTGG - Intergenic
1170231846 20:14057082-14057104 AAATGTGCATGGTGGGAAGCAGG - Intronic
1170947192 20:20901728-20901750 ATGTGACCATTGGGGGAAGCTGG - Intergenic
1171264943 20:23763582-23763604 GCCTGAGCATGGAGTGCAGCAGG - Intergenic
1172128536 20:32639960-32639982 TCGTGAGAATGAAAGGAAGCAGG - Intergenic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1173876676 20:46376652-46376674 AAGGGAGCAAGAAGGGAAGCAGG - Intronic
1174113796 20:48213683-48213705 ACGTCAGCCTGGAGTGGAGCAGG - Intergenic
1174168055 20:48598860-48598882 ACGTCAGCCTGGAGTGGAGCAGG + Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178956033 21:37022831-37022853 ACTTGAGGATGGAGGGAGGAGGG - Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179890312 21:44331822-44331844 ACGTGAGGCTGGAGGGCAGCGGG - Exonic
1180160704 21:45997637-45997659 TGGTGACCTTGGAGGGAAGCAGG - Intronic
1181461594 22:23089085-23089107 AGGTGAGGAGGGAGGGAGGCAGG + Intronic
1182942265 22:34288093-34288115 ACATGAGCTTTGTGGGAAGCTGG - Intergenic
1185399348 22:50607913-50607935 GCCTGTGCCTGGAGGGAAGCTGG - Intronic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950017709 3:9765931-9765953 AGGAGAGGCTGGAGGGAAGCTGG - Exonic
953109309 3:39918371-39918393 ACATGAGCATTCAGGGAAGAGGG - Intronic
954840784 3:53509574-53509596 AGGTGAGGCTGGAGGGAATCAGG + Intronic
956978561 3:74610776-74610798 GGGTGAACATGGAGGGAAGTGGG + Intergenic
957002847 3:74906796-74906818 ATTTGAACATGGAGGAAAGCAGG - Intergenic
958551494 3:95619518-95619540 ACTTGAGGATGGAGGGAGGGAGG + Intergenic
958822624 3:98993045-98993067 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
960280296 3:115774088-115774110 ATGCGAGCATGGAGGAAGGCAGG + Intergenic
962860974 3:139401181-139401203 ACGTGAGGATGGAGGGTGGGAGG - Intergenic
962875952 3:139536194-139536216 ACTTGTGAATGGAGGGGAGCTGG - Intronic
963093150 3:141505623-141505645 ACCTGATCATGGAGGGATGGAGG + Intronic
963411170 3:144930061-144930083 ACTTGAGGATGGAGGGTAGGAGG + Intergenic
964123970 3:153216868-153216890 AAATGAGCATGGAAGGAAACGGG - Intergenic
964162356 3:153660520-153660542 ACTAGAGCAGGGAGGGAAGGGGG - Intergenic
965838058 3:172872684-172872706 AACAGAGAATGGAGGGAAGCTGG - Intergenic
967324259 3:188223587-188223609 ATTTGTGCCTGGAGGGAAGCTGG + Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968732470 4:2276112-2276134 ACGTGAGAATTCAGGGCAGCGGG + Intronic
969834652 4:9830849-9830871 AGGTGAGCATGAAGGGATGTGGG + Intronic
971590811 4:28467026-28467048 GCGAGAGAATGGAGGGAATCCGG + Intergenic
972399006 4:38682421-38682443 ACGTGATCATGTAGTGATGCCGG - Intronic
973001832 4:44961404-44961426 GCGTGAGCATGGAAGGGAGAAGG + Intergenic
973135278 4:46699112-46699134 ACTTGGGCATGGAGGGCTGCAGG - Intergenic
973142110 4:46781911-46781933 GCTTGAGCATGGAGGGCTGCAGG - Intronic
973158053 4:46982409-46982431 ATGTGAACATGGAGAGAAGATGG + Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974678791 4:65134025-65134047 ACTTGAGGATGGAGGGCAGGAGG + Intergenic
977726531 4:100302782-100302804 TCCAGAGCATGGAGGGAAGGCGG - Intergenic
978807716 4:112818160-112818182 ACATCAGCTTGCAGGGAAGCTGG + Intronic
979403908 4:120285375-120285397 AGCAGAGCATGGAGAGAAGCAGG + Intergenic
981936789 4:150247896-150247918 ACAAGAGGATGGAGGGAAACTGG - Intronic
982049099 4:151481892-151481914 ACATGAGCTTGAAGAGAAGCTGG - Intronic
983067349 4:163226886-163226908 ACATGAGCAGGGCGGGAAGAGGG + Intergenic
983155641 4:164344219-164344241 ACTTGAGGGTGGAGGGAAGGAGG + Intronic
983671286 4:170240834-170240856 ACAGGAGCAAGGAGGGAAACAGG - Intergenic
983701930 4:170607567-170607589 ACCTGAGCATGGAGGGTGGGAGG - Intergenic
985796585 5:1966619-1966641 AGGGGAGCAAGGAGAGAAGCCGG - Intergenic
987520839 5:18981400-18981422 ACTTGAGGATGGAGGGTAGTGGG - Intergenic
988149210 5:27354133-27354155 ACGTGATCATTGAAGGATGCTGG - Intergenic
990122798 5:52476075-52476097 ACTTGGGCATGGAGGGACACTGG + Intergenic
990721435 5:58700331-58700353 ACGTGAACATGTAGAGAATCAGG - Intronic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
992142221 5:73810082-73810104 TGGTGAGCAAGGAGGTAAGCTGG + Intronic
994613797 5:102078352-102078374 ATGCCTGCATGGAGGGAAGCAGG + Intergenic
997858145 5:137391666-137391688 AATTGACCATGGAGGGGAGCGGG - Intronic
998050474 5:139028621-139028643 ATGTTAACATTGAGGGAAGCTGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998601097 5:143586022-143586044 AAGTGAACAGGGAGGGAAGGAGG - Intergenic
1001295505 5:170496086-170496108 AAGTGAGCAGGGAGGGGAGGAGG - Intronic
1001560813 5:172667877-172667899 GTGGGAGCAAGGAGGGAAGCGGG - Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002361633 5:178676364-178676386 ATGTCACCATTGAGGGAAGCCGG - Intergenic
1002528952 5:179832366-179832388 ACGTGAGCCTGGAGGTGTGCAGG + Intronic
1002898474 6:1392533-1392555 AGGGGAGCAGGGAGGGCAGCTGG - Intronic
1003387518 6:5683012-5683034 ACGTGTTCAGAGAGGGAAGCAGG + Intronic
1003973158 6:11318218-11318240 ATGTGATCATGGAGGCAGGCAGG - Intronic
1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG + Intronic
1005582960 6:27251118-27251140 ACGTAAGGATGGCGGGCAGCAGG + Exonic
1006224092 6:32521884-32521906 AGGTGAGCATGGTGGGGGGCGGG - Exonic
1015442510 6:133264758-133264780 ACGTGAACATGGAGTGGAGGGGG - Intronic
1018628763 6:165804921-165804943 AGGGGAGCATGGAGGGACGTGGG + Intronic
1018628824 6:165805121-165805143 AGGGGAGCATGGAGGGACGTGGG + Intronic
1019346082 7:531530-531552 AGGTGAGCAGGGAGGTGAGCAGG + Intergenic
1020012531 7:4814574-4814596 TGGTGAGCAGCGAGGGAAGCAGG + Intronic
1023567519 7:41538359-41538381 ACATGAGGCTAGAGGGAAGCAGG + Intergenic
1024017429 7:45329734-45329756 AGGGAAGCATGGAGGGAAGTTGG - Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026533859 7:71223709-71223731 ACTTGAGCATGGAGGGTGGAGGG - Intronic
1026602923 7:71791546-71791568 ACTTGAGGATGGAGGGTAGGAGG + Intronic
1026898126 7:74022170-74022192 TCCTGAGCATGGAGGGCTGCGGG + Intergenic
1030473908 7:110003572-110003594 ACCTGAGGATGAAGGGAAGGAGG + Intergenic
1032661374 7:133987466-133987488 AGGAGAGAAAGGAGGGAAGCGGG + Intronic
1032714762 7:134498035-134498057 ACTTGAGCAGGGAGGGTAGGAGG - Intergenic
1033931698 7:146531215-146531237 ACTTGAGGATGGAGGGAGGGAGG + Intronic
1034124453 7:148658431-148658453 GGGTGAGCATGGAGGACAGCTGG + Intergenic
1034262694 7:149766530-149766552 ATGTGAACCTGGAGCGAAGCAGG - Intronic
1034946280 7:155263736-155263758 GCGAGAGCAGGGAGGGAAGTGGG + Intergenic
1036392640 8:8337875-8337897 ACATGAGCTTGGTGGGAAGCAGG - Intronic
1036625135 8:10464392-10464414 ACGTGAGGATGCAGAGAAGGTGG + Intergenic
1037010941 8:13841648-13841670 AAGTGTGCATGGGGGGATGCTGG + Intergenic
1037738376 8:21584843-21584865 ACGGGTGCATGGAGGAATGCAGG + Intergenic
1037802627 8:22043756-22043778 AGGTGTGCATGGAGGGAGGTGGG - Intronic
1038777549 8:30544604-30544626 ACCTGGGCATGCAGTGAAGCGGG - Exonic
1038966330 8:32576967-32576989 ACTAGAGCAGGGAGGGAAGGAGG - Intronic
1039473099 8:37826120-37826142 AAGTGAGCGGGGAGGGAAGGGGG + Intronic
1040407615 8:47121803-47121825 ACTTGAGGGTGGAGGGCAGCAGG + Intergenic
1040492975 8:47941984-47942006 GCGTGGGCCTGCAGGGAAGCCGG - Intronic
1043506980 8:80911813-80911835 ACTTGAGGATGGAGGGCAGGAGG - Intergenic
1045507447 8:102788813-102788835 AGGTGAACAGGGAGGGAAGAGGG - Intergenic
1045610104 8:103829701-103829723 ACTTGAGGATGGAGGGTAGGAGG + Intronic
1047397422 8:124514259-124514281 TGGGGAGCAGGGAGGGAAGCGGG + Intronic
1047832272 8:128647760-128647782 AGGTGGGCAGGGAGGGAGGCAGG - Intergenic
1048211498 8:132457954-132457976 TCATGACCATGGAGGGAGGCAGG - Intronic
1048549810 8:135424015-135424037 ACGTGAGCATGGTGGGGAAGAGG - Intergenic
1049348814 8:142153192-142153214 ACAGCAGCATGGAGAGAAGCTGG + Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1054138671 9:61456131-61456153 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1054789451 9:69242047-69242069 ACGTGAGGATGTAGGAAATCGGG + Intronic
1055716978 9:79128512-79128534 ATGTTAGTATGGAAGGAAGCTGG - Intergenic
1056275782 9:84992803-84992825 ATGTTACCATTGAGGGAAGCTGG + Intronic
1057380683 9:94564656-94564678 ACGTGAGGGTGGAGGGAGGGAGG + Intronic
1059541498 9:115134872-115134894 CCCTGAGCATGGAGGGAGGAAGG - Intergenic
1059678192 9:116560549-116560571 ACTTGAGGCTGGAGGGAAGCTGG - Intronic
1060277623 9:122193862-122193884 AGGGGAGCTGGGAGGGAAGCGGG + Intronic
1061911049 9:133724518-133724540 TGGTGAGGATGGAGGGGAGCTGG + Intronic
1062257608 9:135635821-135635843 ACGTGGGAATGGATTGAAGCTGG - Intronic
1062665667 9:137670180-137670202 ACGTGAAGCTGGTGGGAAGCAGG - Intronic
1185509484 X:652444-652466 ATGTGAGCTGGGAGGGAAGTGGG + Intronic
1185875965 X:3702638-3702660 ACGAGGGCATGGAGGCCAGCAGG + Intronic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1187149545 X:16669126-16669148 GCTTGAGCATGGTGGGCAGCAGG + Intronic
1192054119 X:67756138-67756160 AGGTTAGCAAGGAGGGAAGGAGG - Intergenic
1192075785 X:67994716-67994738 ACTTGAGGGTGGAGGGAGGCAGG - Intergenic
1193160582 X:78224603-78224625 ACTTGAGGATGGAGAGTAGCAGG + Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1199363186 X:146945833-146945855 AGCAGAGCATTGAGGGAAGCAGG + Intergenic
1199376900 X:147123509-147123531 ACTAGAGCAGGGAGGGAAGGAGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1200789615 Y:7287787-7287809 ACGAGGGCATGGAGGCCAGCAGG - Intergenic