ID: 1129000973

View in Genome Browser
Species Human (GRCh38)
Location 15:72333582-72333604
Sequence TCCAGGAGTTTGAGAGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2234
Summary {0: 1, 1: 4, 2: 57, 3: 494, 4: 1678}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129000973_1129000979 17 Left 1129000973 15:72333582-72333604 CCAGTTGCTCTCAAACTCCTGGA 0: 1
1: 4
2: 57
3: 494
4: 1678
Right 1129000979 15:72333622-72333644 TCTTGGCTTCCCAAAGTGCTGGG 0: 329
1: 10951
2: 109937
3: 228643
4: 233537
1129000973_1129000980 25 Left 1129000973 15:72333582-72333604 CCAGTTGCTCTCAAACTCCTGGA 0: 1
1: 4
2: 57
3: 494
4: 1678
Right 1129000980 15:72333630-72333652 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
1129000973_1129000975 0 Left 1129000973 15:72333582-72333604 CCAGTTGCTCTCAAACTCCTGGA 0: 1
1: 4
2: 57
3: 494
4: 1678
Right 1129000975 15:72333605-72333627 TTCAAGTGATCCTCCTGTCTTGG 0: 34
1: 923
2: 8482
3: 28932
4: 69258
1129000973_1129000978 16 Left 1129000973 15:72333582-72333604 CCAGTTGCTCTCAAACTCCTGGA 0: 1
1: 4
2: 57
3: 494
4: 1678
Right 1129000978 15:72333621-72333643 GTCTTGGCTTCCCAAAGTGCTGG 0: 172
1: 6258
2: 71665
3: 185385
4: 222853

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129000973 Original CRISPR TCCAGGAGTTTGAGAGCAAC TGG (reversed) Intronic
Too many off-targets to display for this crispr