ID: 1129002599

View in Genome Browser
Species Human (GRCh38)
Location 15:72346807-72346829
Sequence CTTTGCTGCTGGGGAACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129002599_1129002605 18 Left 1129002599 15:72346807-72346829 CCCTCTGTTCCCCAGCAGCAAAG 0: 1
1: 0
2: 2
3: 27
4: 250
Right 1129002605 15:72346848-72346870 GACCATTGAGCTCACACCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 81
1129002599_1129002607 25 Left 1129002599 15:72346807-72346829 CCCTCTGTTCCCCAGCAGCAAAG 0: 1
1: 0
2: 2
3: 27
4: 250
Right 1129002607 15:72346855-72346877 GAGCTCACACCTCAGGACAGAGG 0: 1
1: 0
2: 0
3: 35
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129002599 Original CRISPR CTTTGCTGCTGGGGAACAGA GGG (reversed) Intronic
900648454 1:3719460-3719482 CTGTGCTGGTTGGGGACAGAAGG - Intronic
903967051 1:27097382-27097404 ATTTCCTGCTAGGGAACCGATGG + Intergenic
904182262 1:28674430-28674452 CTTTGTACATGGGGAACAGAGGG - Intronic
904353263 1:29922563-29922585 CATTGCTGCTGTGGCTCAGAGGG + Intergenic
904399779 1:30248441-30248463 CTTTGCTACGGGAGAGCAGAGGG - Intergenic
904833722 1:33321425-33321447 CTTTGGTTCTTGGGAACAGCTGG + Intergenic
905300904 1:36985626-36985648 CTTTCCTGCTGGGGCATTGAGGG + Intronic
906701716 1:47864603-47864625 GTTTGCTTCTTAGGAACAGATGG + Intronic
907131926 1:52104799-52104821 CTCTGCTTCTGGGGAACTTAAGG - Intergenic
908011357 1:59780605-59780627 CTTGGCAGCTGAGGAATAGAGGG - Intergenic
909063344 1:70904363-70904385 CTTTGCAACTGGGTAACAGGTGG + Intronic
910270649 1:85390539-85390561 CTTTGGGGTTGGGGAACACATGG + Intronic
910846146 1:91606408-91606430 CCTTGCTGGTGGGGAGGAGAGGG - Intergenic
911382806 1:97137136-97137158 TTTTGTTGCTGTGGAACAGCAGG + Intronic
912499653 1:110113487-110113509 CTTGGCTGCTGGGGAGCCTAGGG - Exonic
912547928 1:110464784-110464806 CTTTGGTGCTTGGGAACTGGTGG - Intergenic
914697096 1:150094084-150094106 CTTTGCTCCTGTGTAACAAATGG - Intronic
916590004 1:166181106-166181128 CTGTGCTGTAGGGGAACTGATGG + Intergenic
917117938 1:171621337-171621359 ATTTGCTGCTTGGGAAGATAAGG - Intergenic
919812830 1:201419830-201419852 CTGTCATGCTGGGGCACAGAGGG + Intronic
920686651 1:208113982-208114004 CTTTGCTGTTGTTGAATAGAAGG + Intronic
920877543 1:209850606-209850628 CTGTGCAGCTGGGAAAGAGATGG + Intronic
1063514751 10:6684769-6684791 CCTTTCTGCTGCAGAACAGATGG + Intergenic
1063907802 10:10798696-10798718 ATGGGGTGCTGGGGAACAGACGG - Intergenic
1065792766 10:29276542-29276564 CTTTGCTGCTGCAGAAATGAGGG - Intergenic
1066153638 10:32651262-32651284 ATTTGGTGCTGGGAAACAGCTGG + Intronic
1066188232 10:33031311-33031333 GTCTGCTCCCGGGGAACAGAGGG + Intergenic
1067431598 10:46249320-46249342 CCTTGCTGCTGGGGCACACAAGG + Intergenic
1067441822 10:46312854-46312876 CCTTGCTGCTGGGGCACACAAGG - Intronic
1067720666 10:48725398-48725420 CTTTCCTGATGGCTAACAGAGGG - Intronic
1067906276 10:50294621-50294643 CTCTGCTCCTGGGGAGGAGAGGG - Intergenic
1069615724 10:69805033-69805055 CTTTGAGGCTGGGGGCCAGAGGG + Intronic
1069630515 10:69894592-69894614 CTTCTCTGCTGGGAAATAGATGG - Intronic
1069795540 10:71049589-71049611 CTTTGCCTCTGGGGACTAGATGG - Intergenic
1070834089 10:79437004-79437026 CTTGGCTGTTGGGGAAAGGAAGG + Intronic
1071422560 10:85515307-85515329 CTTTGCACCTGGGCAAGAGAAGG - Intergenic
1071495488 10:86164910-86164932 CTTGGGTGATGGGGACCAGAAGG + Intronic
1073331947 10:102675769-102675791 GTTTGCTGCTGGGGAGGACATGG - Exonic
1075389791 10:122084046-122084068 CTTTGCTCCTTGGGAAGAGGAGG - Exonic
1075542660 10:123328548-123328570 CTTTGCTGCTGGTGAGCAGGAGG - Intergenic
1077575585 11:3380554-3380576 CTCTGCTTCTGGGGATGAGATGG + Intergenic
1079242992 11:18733748-18733770 TTTTGCTGCTGGGCAAGGGAAGG - Intronic
1080326270 11:31076960-31076982 CGTAGATGCTGGGAAACAGAAGG - Intronic
1080411872 11:32032732-32032754 CGCTGCTGCTGGAGAGCAGAAGG - Intronic
1080429308 11:32184043-32184065 CCTTACTGCTGGGAAATAGATGG + Intergenic
1082726909 11:56747159-56747181 CTTTGATGCTGGGACAGAGACGG - Intergenic
1083874837 11:65516756-65516778 GCTTGCCCCTGGGGAACAGATGG + Intergenic
1084313616 11:68331160-68331182 CTTTACTGGTTGGGAAGAGACGG + Intronic
1084459660 11:69289508-69289530 CTTTACTGTTGGGGAACGGGAGG + Intergenic
1084478178 11:69400731-69400753 TTTGGCTCCTGGGGAACTGAAGG - Intergenic
1085101089 11:73800631-73800653 ATTTGCTGATGGGGAGGAGAGGG + Intronic
1088684817 11:112275750-112275772 CTTTGCTCCTGGGCAACATATGG - Intergenic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1090221102 11:125026755-125026777 AATAGCTGTTGGGGAACAGATGG + Intronic
1091630502 12:2156799-2156821 CATTGCTGCTGGGGGAGAAATGG - Intronic
1092753326 12:11739243-11739265 TATTGCTGTTGGGGAAAAGAAGG + Intronic
1092842364 12:12555121-12555143 CTCAGCTGCTCGGGAAGAGAAGG + Intronic
1094159791 12:27378537-27378559 CGTTGCTGCTGTGGAACATTTGG + Intronic
1094184987 12:27632282-27632304 TTTGGCTGCTTGGAAACAGAGGG + Intronic
1096631263 12:52928092-52928114 CCTTTGTGCTGGGGAAAAGAAGG + Intronic
1097100790 12:56587637-56587659 CTGTGCTGCTGAGGGAGAGATGG - Exonic
1098743263 12:74201375-74201397 CTTTGGAACTGGGTAACAGATGG - Intergenic
1100349410 12:93764642-93764664 CCTTCCTGCTAGGGAAGAGATGG + Intronic
1100420027 12:94423912-94423934 CTGTGCTGCTGAGGCAGAGATGG + Intronic
1102702828 12:114854552-114854574 CTTTCCTGTTGGTGAACACATGG + Intergenic
1103499734 12:121392079-121392101 CTCTGCAGCTGGAGAACAGATGG - Intronic
1104416551 12:128600574-128600596 CTTTGCAGCTGGGCACCACAGGG + Intronic
1104725237 12:131071627-131071649 CAGTGCTGCTGGGCCACAGAGGG + Intronic
1108098464 13:46929596-46929618 CTCTGCTGCTGTGAAGCAGAAGG + Intergenic
1109708837 13:66137180-66137202 CTTTGCTTCTGTGTCACAGATGG + Intergenic
1111644161 13:91009269-91009291 CTTTGCTGTTAGGGCATAGAAGG - Intergenic
1112938237 13:104827459-104827481 CTGTGCTGTAGGGGAAGAGATGG + Intergenic
1113698920 13:112368520-112368542 CTTTGCTGCTGGAGAAATGTGGG + Intergenic
1116666181 14:47778762-47778784 CTTAGCAGCTGAGGAACAGCAGG - Intergenic
1116827731 14:49688405-49688427 CTTTGCTGCCGGGAAACTGAGGG + Intronic
1118312858 14:64705808-64705830 GTTTCCTCCTGGGGAACAGCTGG - Intronic
1118795797 14:69142468-69142490 CTCTGCTTCTGTGGAAAAGAAGG - Intronic
1121162298 14:91755036-91755058 CTTTGCTGGTGGGGAGCAGGGGG - Intronic
1121774530 14:96582073-96582095 GTTTGCTGCTCTGGAAGAGAAGG + Intergenic
1122322174 14:100861733-100861755 CTTTGCTGCAGCGGATCATAAGG + Intergenic
1122769518 14:104091797-104091819 CATTGCTGCTGGGGGAGGGAAGG + Intronic
1122870211 14:104634996-104635018 CTTCTCCGCTGGGGAGCAGAGGG - Intergenic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1125524094 15:40364537-40364559 CTTTGCTGGTGAGGAACCAAGGG + Exonic
1126438191 15:48657455-48657477 CTCTGCTGCTGGCAAACACAAGG + Intergenic
1127725236 15:61743400-61743422 CACTGCTGCTGGGGAGCAGTTGG - Intergenic
1129002599 15:72346807-72346829 CTTTGCTGCTGGGGAACAGAGGG - Intronic
1130101960 15:80900961-80900983 CCTTTCTGATGGGAAACAGATGG + Intronic
1131782946 15:95879871-95879893 TACTGCTGCTGAGGAACAGAGGG + Intergenic
1132647819 16:1007180-1007202 CTTTGGTGCTGGGGGACAGAGGG + Intergenic
1133054443 16:3138508-3138530 TGCTGCTCCTGGGGAACAGACGG - Exonic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133929828 16:10223065-10223087 CTATTCTGCAGGAGAACAGATGG + Intergenic
1137028010 16:35497937-35497959 CTTAGCTGTGGGTGAACAGAAGG + Intergenic
1137502535 16:49022726-49022748 CTTGGCTGCTGGGGAGCCGGCGG + Intergenic
1139094600 16:63690393-63690415 ATTGGCTGAAGGGGAACAGAGGG - Intergenic
1139120296 16:64008022-64008044 CCTATCTGCTTGGGAACAGAAGG - Intergenic
1139884212 16:70197199-70197221 CTCTGCTTCTTGGGAACAGGAGG + Intergenic
1140368303 16:74398297-74398319 CTCTGCTTCTTGGGAACAGGAGG - Intergenic
1140476843 16:75243250-75243272 CCTTTCTGCTGGGGAACAGGTGG - Intronic
1140575780 16:76166863-76166885 CTTTACTCCTTGGCAACAGAGGG + Intergenic
1140731788 16:77863289-77863311 CTTTGCTTCTAGCCAACAGATGG + Intronic
1142026297 16:87815811-87815833 CATAGCTGCTGGCCAACAGAAGG + Intergenic
1142582467 17:950613-950635 CTTTGCTTTTGGGGAACGGACGG - Intronic
1143097488 17:4486155-4486177 CTTGGCAGGTGGGGAACAGCAGG + Intronic
1143515945 17:7419236-7419258 CAGCGGTGCTGGGGAACAGATGG + Exonic
1143667075 17:8369126-8369148 CTCCTCTGCTGGTGAACAGATGG - Exonic
1146151377 17:30475509-30475531 CTATGCTGCTGGGGGACATAGGG - Intergenic
1146923207 17:36727490-36727512 CTATCCTGGTGGGGAAGAGAAGG + Intergenic
1150413176 17:64964100-64964122 CTTTGCTGCTATGAAACAGCTGG + Intergenic
1152444128 17:80330745-80330767 CTTGGCTGCTGGGGTGAAGAAGG + Intronic
1152681710 17:81671884-81671906 CAGGGCTGGTGGGGAACAGAAGG - Intronic
1153056327 18:949838-949860 CTTTGCTGCTGGGGGAGGGTGGG + Intergenic
1153093593 18:1375368-1375390 CTTAGCTGCTGAGGAAAAGTAGG + Intergenic
1153933569 18:9900764-9900786 CTTTGCTGCCTGGGATGAGAGGG - Intergenic
1155784875 18:29883854-29883876 ACTTGCTGATGGGGTACAGAAGG + Intergenic
1155872268 18:31042919-31042941 GGTGGCTGCTGGGGAGCAGAGGG - Intergenic
1156708825 18:39916843-39916865 GTTTGCTGGTGAGGAAGAGAAGG + Intergenic
1160042657 18:75359861-75359883 CTTTTGAGCTGGGGAACAGCAGG + Intergenic
1160125912 18:76171274-76171296 CTTTGCTGCTGTGGGAGAGGAGG - Intergenic
1161060129 19:2210623-2210645 CTCTGGTGCTGAGGAAGAGAAGG + Exonic
1161720281 19:5898442-5898464 CTGTGCTTGTGGGGAGCAGATGG - Intronic
1162224534 19:9209283-9209305 ATTTGCTGCTGAGGAACATGGGG - Intergenic
1165096093 19:33410664-33410686 CCATGCTGCTGGGGGGCAGAGGG + Intronic
1165825018 19:38700804-38700826 CATTGCTCCTGGGGAGGAGAGGG + Intronic
1165923648 19:39314196-39314218 CAATGCTGCTGGGGAAGCGACGG - Exonic
1166111642 19:40626641-40626663 GATTGCTGCTGGGGACCTGAGGG - Intronic
1167191819 19:47995645-47995667 ATTTGCTGCTGAGAAGCAGAAGG + Intronic
1168137023 19:54359055-54359077 CTGGGCTGCTGGGGCACAGCGGG - Intronic
1168161058 19:54510074-54510096 CTGGGCTGCTGGGGCACAGCGGG + Intronic
925171772 2:1754541-1754563 ATGTGCTGATGGGGAACTGACGG + Intergenic
925680293 2:6413422-6413444 CTTTGTAGCTGGGGAAAAGCTGG - Intergenic
925719205 2:6811687-6811709 CTGTGCTGTTGGGGACCAGCTGG + Intergenic
926118348 2:10227390-10227412 TTTTGCTGGTGGGGAACAAAAGG - Intergenic
926753561 2:16218799-16218821 CTGGGCTGCTGGTGAATAGATGG - Intergenic
926797004 2:16627316-16627338 CTCTGCTGCTGGTGAACTGTGGG - Intronic
927073972 2:19558035-19558057 TTTTGCTGATGGGGAATTGAGGG - Intergenic
927492818 2:23531829-23531851 GTCTGCTGATGAGGAACAGATGG - Intronic
929266969 2:39929135-39929157 CTGTGCTTCTGGGGAAAAGCGGG - Intergenic
929737583 2:44566600-44566622 TTTTGCTGCTGTGGCAAAGAGGG - Intronic
932861115 2:75292020-75292042 CACTGCAGCTGGGGAACAAAAGG - Intergenic
932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG + Intergenic
933724477 2:85418792-85418814 CTACCCTGCTGGGGAAGAGATGG + Intronic
934629494 2:95901333-95901355 CTTTGTCTCTGGGGACCAGAAGG + Intronic
934629909 2:95906949-95906971 CTTTGTCTCTGGGGACCAGAAGG + Intronic
934707990 2:96498055-96498077 CTATCCTGTTGGGGAACAGGTGG + Exonic
934791072 2:97060599-97060621 CTTTGCTTCTGGGGATGAGGAGG - Intergenic
934815375 2:97321931-97321953 CTTTGCTTCTGGGGATGAGGAGG + Intergenic
934822320 2:97386552-97386574 CTTTGCTTCTGGGGATGAGGAGG - Intergenic
935332475 2:101987132-101987154 CATTCCAGCTGGGTAACAGAGGG + Intergenic
936735531 2:115438291-115438313 CATTGCTGCTGCGGAAGAAATGG + Intronic
938947594 2:136227202-136227224 CTGTGCAGCTGGGTGACAGATGG + Intergenic
943612204 2:190046183-190046205 CTCTCCTGGAGGGGAACAGAAGG - Intronic
943992183 2:194710568-194710590 CATTGCTCCTGGGGAAAATACGG + Intergenic
945025433 2:205615676-205615698 CTTTGGTGCTGGGGAGGGGAAGG - Exonic
945926231 2:215807322-215807344 CTAAGCACCTGGGGAACAGAAGG - Intergenic
948406807 2:237727682-237727704 CTGAGCTGCGGGGGAGCAGACGG + Intronic
948988811 2:241541599-241541621 ATCTGCTGTTGGGGAACGGAGGG - Intergenic
1168808087 20:684652-684674 CTCGGCTGGTGGGGAAGAGAGGG - Intergenic
1171265393 20:23767667-23767689 CTGAGCTCCTGGGGAAGAGAAGG - Intergenic
1171321632 20:24249165-24249187 CTTTTCTGCAGGGGAAATGAAGG - Intergenic
1173382777 20:42560981-42561003 ACTTCCTCCTGGGGAACAGAAGG + Intronic
1173749806 20:45468384-45468406 CTTTGCTGCTGGAGGCTAGAGGG - Intergenic
1175389840 20:58620156-58620178 CTTTGCAGCTGGGGAAATGAAGG + Intergenic
1179419692 21:41225594-41225616 GGTTGCTTCTGGGGACCAGAAGG + Intronic
1181807960 22:25386379-25386401 CTTTACTGGTTGGGAAGAGAGGG - Intronic
1182372148 22:29818907-29818929 CTGGGCTGCTGGGGAAGAAAAGG - Intronic
1182774851 22:32823472-32823494 CTTTGGGGCTGGGACACAGACGG - Intronic
1183721924 22:39567699-39567721 CTTGGCTGCTGGTGAAGACAGGG - Intergenic
949134953 3:553321-553343 CTTTGGTGCTGGTAAGCAGATGG + Intergenic
949606257 3:5657552-5657574 CATTGCAGCTGGAGAATAGAGGG + Intergenic
950152215 3:10696610-10696632 CTTTGTTGCTGTGAAGCAGAGGG - Intronic
950468830 3:13172252-13172274 GTTTGCGGCTGGGGAGTAGATGG + Intergenic
950496489 3:13337193-13337215 CTGTGCTGCTGGGGGACCCATGG - Intronic
953477770 3:43220669-43220691 CTGTGCTGCTGAGGATCATAGGG - Intergenic
953679791 3:45030589-45030611 GATTGTTGCTGGGGATCAGATGG - Intronic
954519712 3:51213842-51213864 GTTGGACGCTGGGGAACAGAGGG + Intronic
954630906 3:52047210-52047232 GTTCCCTGCTGGGGGACAGAGGG - Intergenic
954790166 3:53126836-53126858 ATTTGCTGCTGGGATGCAGAAGG - Intronic
955930673 3:64053765-64053787 CTGTGCTGCTGTGGTACACATGG + Intergenic
960040271 3:113143417-113143439 CTGGGGTGCTGGGGAACTGAAGG + Intergenic
960586356 3:119323928-119323950 CTTTCCTGCTGGGAATAAGAAGG + Intronic
961833004 3:129634026-129634048 CTTTGGAGCTTGGGACCAGAGGG - Intergenic
962921560 3:139954725-139954747 CTTTGATGGTGTGGAACAGCTGG + Intronic
962990582 3:140573828-140573850 CCCTGTTTCTGGGGAACAGAAGG + Exonic
964204750 3:154160940-154160962 CCCTGCTGCTGGGGTAAAGAGGG - Intronic
964951363 3:162298345-162298367 CTATGGAGCTGGGGAAGAGAAGG + Intergenic
967174339 3:186849207-186849229 CTTTTCTGCTGGGAAACAGGAGG - Intronic
967877760 3:194278457-194278479 CTGTGCTGCTGGGGCCAAGAGGG - Intergenic
967931161 3:194691316-194691338 CTTTGCTCCTGGAGCTCAGAGGG + Intergenic
972714486 4:41632224-41632246 CTTTGCTCCTGCTGTACAGAGGG - Intronic
976771183 4:88654156-88654178 CTTTGGTGCTGGGGATATGATGG + Intronic
977382631 4:96295700-96295722 CTTTGCTGCTTGGGACCAGGTGG + Intergenic
977768778 4:100831863-100831885 ACCTACTGCTGGGGAACAGAGGG + Intronic
978372882 4:108046842-108046864 CGGTGCAGCTGGGGAACAGCTGG - Intergenic
979071990 4:116219764-116219786 CTATGCTGGTGAGGGACAGAGGG - Intergenic
979310257 4:119194667-119194689 CTTTTCTTTTGGGAAACAGAGGG + Intronic
981537676 4:145816624-145816646 CTAGGCTGGTGGGGGACAGATGG + Intronic
989277795 5:39610033-39610055 CTTTGCTGCTGGAGCAGAGAAGG + Intergenic
990411725 5:55547871-55547893 CTTGGCTGCTGGAGAGCAGCAGG + Intergenic
993316676 5:86416243-86416265 CTTTGCTTGTGGGGCAAAGAAGG - Intergenic
994561718 5:101382363-101382385 CTTTGGAACTGGGTAACAGATGG - Intergenic
995407725 5:111819598-111819620 CATTGCTCCTGGGGAAAATATGG + Intronic
995953823 5:117749897-117749919 CTTCGCTTCTGGGCAACAGTAGG - Intergenic
997195385 5:131975646-131975668 CTTTGCTGGCGGGGCACAGCAGG - Intronic
997479355 5:134172263-134172285 CTTTGGTGCTGGTGAAAAGAAGG - Intronic
997718052 5:136056843-136056865 GTTTGCTGCTGGGGCCCTGAGGG - Intronic
1000373233 5:160556895-160556917 CTTTGCTTATGGGGAAAAGAAGG + Intergenic
1002407595 5:179048044-179048066 CTTTGGGGCTGGTGAACACATGG - Intergenic
1002456635 5:179348971-179348993 CTTTGCTGTTGGCAAACAGCGGG + Intergenic
1002616837 5:180461384-180461406 CTATGAGTCTGGGGAACAGATGG - Intergenic
1002778023 6:344944-344966 CTGTGCTGCTGGGGCATTGAGGG + Intronic
1004277580 6:14252262-14252284 ATTTGCTACTGTGGAAAAGATGG + Intergenic
1006502674 6:34468331-34468353 CTTTGGTCCTGGGGAATAGAGGG + Intronic
1007048658 6:38803403-38803425 CTTTGCTTCTGGGGAAGGGAGGG - Intronic
1007137047 6:39532455-39532477 CTTTGCTGGTTGGGAAAAGGGGG - Intronic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1007487212 6:42189322-42189344 ATATGCTCCTGGGGAAAAGAGGG + Intronic
1008968182 6:57335704-57335726 CTTTGATGATGGTGTACAGATGG - Intronic
1010660319 6:78562856-78562878 CCTTGCTCCTGGAGAATAGATGG + Intergenic
1013091285 6:106902893-106902915 GTTTTCTGATGGGTAACAGATGG + Intergenic
1016786231 6:148013620-148013642 TTTACCTGCTGGGGATCAGAAGG + Intergenic
1016852300 6:148633013-148633035 TTTTTTTGCTGGGGCACAGAGGG - Intergenic
1018475434 6:164135580-164135602 CTTTGCTGCTATGGAACAAATGG + Intergenic
1021679450 7:23115326-23115348 TTTGGTTTCTGGGGAACAGAGGG + Intronic
1022513776 7:30962552-30962574 CTTTGTAGCTGAGGAACAGAAGG + Intronic
1023327264 7:39073790-39073812 TATTGCAGCTTGGGAACAGAGGG + Intronic
1026300233 7:69091206-69091228 CATTGCTCATGGGGAACTGAGGG - Intergenic
1026850504 7:73720362-73720384 GTTTTTGGCTGGGGAACAGAAGG - Intergenic
1026918552 7:74138373-74138395 CTGTGCTGTGGGGGAAAAGACGG + Intergenic
1027492886 7:78852546-78852568 GTTTGCTGATGGTGTACAGAAGG + Intronic
1028619967 7:92814520-92814542 CTTTCCTGGTTGGGAGCAGAAGG - Intronic
1028829912 7:95315702-95315724 CTTTGCTGCAGGGGATGAAAGGG - Intronic
1031794596 7:126156100-126156122 CTTTGCTGGTGGGCAAGAGAGGG - Intergenic
1032529106 7:132605435-132605457 CTTTGGTCCTGGAGAACAGGTGG + Intronic
1032629675 7:133635025-133635047 CCTTGATTTTGGGGAACAGAAGG + Intronic
1034564963 7:151905962-151905984 CTTTCCTGTTGGGGCAGAGATGG + Intergenic
1035701087 8:1639630-1639652 CTGTGCTGCTGGAGACCATAGGG - Intronic
1037323045 8:17661857-17661879 GTGTGCTGCTGGGGAACAGCTGG + Intronic
1038507806 8:28100881-28100903 ATTTGGTGCTGGGGACCATATGG - Intronic
1039341814 8:36658727-36658749 CCTTGCTGCTGTGAAGCAGAGGG - Intergenic
1040631704 8:49220934-49220956 TTTTGCTGCTGTGGAAAAGAGGG + Intergenic
1041383702 8:57278387-57278409 CTGCGCTGCTGGGGCCCAGAGGG - Intergenic
1042024783 8:64411556-64411578 CTTTGCTGCTGGGGAAGACGGGG - Intergenic
1044057811 8:87594105-87594127 CTTGGTTGCTGGGGGTCAGAAGG - Intronic
1045321353 8:101084231-101084253 TGTTGCTTCTGGGGAACAAAAGG + Intergenic
1046513827 8:115232937-115232959 CTTTGCTGCTGAGGTATAGTGGG - Intergenic
1046544190 8:115627277-115627299 CTTTTCTGCAGGGAAACAAATGG - Intronic
1046811139 8:118535097-118535119 CTTTGATGATGAGGTACAGATGG + Intronic
1047945397 8:129872129-129872151 CTATTCTGCTGATGAACAGAAGG + Intronic
1049002744 8:139836536-139836558 CATTGCTGCAGGGGAGCAGTTGG - Intronic
1049140102 8:140946556-140946578 CGTTGCTTCTGGGAAGCAGATGG + Intronic
1049216024 8:141408797-141408819 ACCAGCTGCTGGGGAACAGAGGG + Intronic
1049346512 8:142142092-142142114 ATTGGCTGCTGGGGCACAGCTGG + Intergenic
1050585220 9:7103783-7103805 CCATGCTGCTGGGGTACTGATGG + Intergenic
1051405528 9:16734000-16734022 CTTTACTGCTGTGGAACACTTGG - Intronic
1055460892 9:76519300-76519322 CTCTTCTCCTGGTGAACAGAAGG - Intergenic
1055628866 9:78201912-78201934 CTTTGCTGTTGGGGTTCAGATGG - Intergenic
1057261647 9:93587865-93587887 CCATGCTGCTGGAGAACGGACGG - Intronic
1057427827 9:94968073-94968095 CTTTGCTGCTGCGGAAAGAATGG + Intronic
1057667607 9:97058036-97058058 CTTTGGTGGTGGGCAGCAGATGG - Intergenic
1058055419 9:100443855-100443877 GTTTCCTGGTGGGGGACAGAGGG + Intronic
1059999129 9:119942530-119942552 CTTTGCTGTAGGGGCTCAGAAGG - Intergenic
1061170048 9:128947417-128947439 CCTCGCTGCTGGAGAACGGAGGG - Exonic
1061565526 9:131436778-131436800 CTTTGTTGCTGGGGGATGGAAGG + Intronic
1186871576 X:13779134-13779156 CTTCGCTGCTGAGTAAGAGAGGG - Intronic
1187691965 X:21877641-21877663 CTGTGGTGCTGGTAAACAGAGGG - Intronic
1189733663 X:44047956-44047978 ATTTGCTGCTGGGGAAGAGAAGG - Intergenic
1190240741 X:48655972-48655994 CCTGGGTGCTGGGCAACAGAGGG - Intergenic
1190487432 X:50941841-50941863 CTCTGCTGGTGGAGGACAGAGGG + Intergenic
1193680735 X:84516149-84516171 GTATGTTACTGGGGAACAGATGG + Intergenic
1195388313 X:104334570-104334592 CTAGGATGCTGGGGAACAAAAGG + Intergenic
1195563586 X:106315371-106315393 CTTAGCTGCTAGGGAAAAGTGGG - Intergenic
1195672911 X:107484253-107484275 CAGTGCTGCTGGGGAAGAAAGGG + Intergenic
1196595264 X:117538629-117538651 CTTTGGTGCTGGCATACAGAAGG + Intergenic
1197843366 X:130774606-130774628 CTTTGGTGTTGTGGAAGAGAAGG + Intronic
1198130240 X:133686877-133686899 CTGGACTGCTGGGGAAGAGATGG + Intronic
1199683471 X:150243505-150243527 CTATGCTGTTGGGGAAAAAAGGG + Intergenic
1200153826 X:153964719-153964741 GTTGGTTGCTGGGGAACAGAAGG + Exonic
1200375408 X:155774770-155774792 CTTTGCTGTTGGGGACTCGAAGG - Exonic