ID: 1129003574

View in Genome Browser
Species Human (GRCh38)
Location 15:72353829-72353851
Sequence ATTTGGGTACACAGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 525}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129003574 Original CRISPR ATTTGGGTACACAGGGAAAA TGG Intronic
900267873 1:1768626-1768648 ATGTGGGGACACAGAGAAGATGG + Intronic
901899401 1:12345879-12345901 ATTTGGAGACACAGAGTAAAAGG - Intronic
902162988 1:14547119-14547141 ATTTTGGTTCACAGGGGAAGAGG - Intergenic
902200176 1:14827414-14827436 CTTTGGGGACTCAGGGCAAAGGG - Intronic
902338748 1:15768797-15768819 ATTTAGGTATAAAGGGAAAAAGG - Intronic
902868502 1:19297168-19297190 ATTTTGCTACACAGAGAAAAAGG + Intergenic
903156630 1:21448825-21448847 AATTGAGGTCACAGGGAAAACGG - Intronic
903464835 1:23544959-23544981 ATTTGGGCACAGAGATAAAAGGG - Intergenic
904352859 1:29920280-29920302 ATGTGAGGACACAGGGAGAAGGG + Intergenic
905989065 1:42316856-42316878 CTTTGGGGACTCAGGGGAAAGGG + Intronic
906413649 1:45601574-45601596 ATTTAGGTAAACAGGGCAAGAGG - Intronic
907604550 1:55803741-55803763 AATTGGAAACACAGGGAAAAGGG - Intergenic
908614224 1:65899863-65899885 ATTTGGGGACTCAGGGACAAAGG + Intronic
908629816 1:66090966-66090988 ATTTGGCTACCTAGGGAAAGGGG - Intronic
910157872 1:84240723-84240745 TTTTGGGGACTCGGGGAAAAGGG - Intergenic
910846300 1:91607583-91607605 CTTTGGGGACTCAGGGAGAAAGG - Intergenic
911466057 1:98253434-98253456 ATCTGGCAACACAAGGAAAATGG + Intergenic
911694605 1:100875526-100875548 AATTGGCTAGAGAGGGAAAAGGG + Intronic
913044141 1:115059112-115059134 CTTTGGGGACTCAGGGGAAAGGG + Intronic
913067608 1:115270956-115270978 GTTTATGTACACAGGGAAGATGG - Intergenic
913172830 1:116247828-116247850 ACTTGGTTAAACAGGGACAAAGG + Intergenic
914679778 1:149931036-149931058 AATGGGGAACACAGGGAATAGGG + Intronic
914978555 1:152390716-152390738 CTTTGGGTACTCATGGGAAAAGG - Intergenic
915324347 1:155073153-155073175 TTATGGGAACACAGGGAAAACGG + Intergenic
915675194 1:157523341-157523363 ATTTTGGTAGACAGGGAATATGG - Intronic
916291015 1:163166178-163166200 AAGAGGGTCCACAGGGAAAAAGG + Intronic
916347211 1:163807147-163807169 ATTTGGTTTCAGAGGAAAAATGG + Intergenic
916490911 1:165301540-165301562 GTCTGGGTAAACAGGGAGAAGGG - Intronic
917062420 1:171055653-171055675 CTTTGGGGACTCAGGGGAAAAGG + Intronic
917144229 1:171870900-171870922 ATTTGAGAAGACAGAGAAAAAGG + Intronic
917601226 1:176576211-176576233 ATTTGGCAACACTGGGGAAAAGG - Intronic
917686129 1:177417916-177417938 AGTTCGATACACAGGGAACAAGG - Intergenic
917771833 1:178287814-178287836 CTTTGGGGACTCAGGGGAAAGGG + Intronic
917789036 1:178487681-178487703 TTTTGGGGACACAACGAAAAGGG - Intergenic
917980532 1:180266348-180266370 ATTAGGGCACACAGGGAGCAAGG - Intronic
918337442 1:183532612-183532634 ATTCTGGAACACAGGGTAAATGG - Intronic
918458993 1:184756122-184756144 ATTAGAGTACAGAGAGAAAAAGG - Intergenic
919243645 1:194948791-194948813 CTTTGGGAACTCAGGGGAAAGGG + Intergenic
919571373 1:199253078-199253100 CTTTGGGGACTCAGGGGAAAAGG - Intergenic
919575900 1:199309252-199309274 ATTTGAATAAACAAGGAAAAGGG - Intergenic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
920661407 1:207918686-207918708 ATTTGGGTTTACAGAGACAAAGG - Intergenic
922429825 1:225540132-225540154 ATTTGGGTACAAAAGAAAGAGGG + Intronic
923924572 1:238610150-238610172 ATATGGGTATCCAGGTAAAAGGG + Intergenic
924161964 1:241242108-241242130 CTTTGGGGACTCAGGGGAAAGGG - Intronic
924162096 1:241243646-241243668 AATAGGGTACAGAGGGATAAAGG + Intronic
1063101485 10:2953815-2953837 ATGTGAGGACACAGGGAGAAGGG - Intergenic
1063198938 10:3768913-3768935 AGTTATGCACACAGGGAAAAAGG + Intergenic
1063391413 10:5652197-5652219 ATTTGGGTACACACTGAAATCGG + Intronic
1063842286 10:10085992-10086014 CTTTGGGGACTCGGGGAAAAGGG - Intergenic
1065270823 10:24031747-24031769 GTTTGAGTAAAGAGGGAAAATGG + Intronic
1065272644 10:24051080-24051102 CTTTGGGAACTCAGGGAGAAGGG - Intronic
1065613995 10:27501451-27501473 AGATGGATCCACAGGGAAAAGGG + Intergenic
1065862990 10:29886998-29887020 ATGTGAGTTCACATGGAAAAGGG - Intergenic
1066556676 10:36622243-36622265 ATGTGCAGACACAGGGAAAAGGG - Intergenic
1066706335 10:38183053-38183075 CTTTGGGGACACAGGGAAAAGGG - Intergenic
1066983621 10:42443009-42443031 CTTTGGGGACACAAGGAAAAGGG + Intergenic
1067376655 10:45733432-45733454 ATCTGGGGAGACAGGGTAAAAGG - Intronic
1067658785 10:48218078-48218100 ATGTGAGGACACAGGGAGAAGGG - Intronic
1067884349 10:50074123-50074145 ATCTGGGGAGACAGGGTAAAAGG - Intronic
1068000956 10:51333601-51333623 TTTTGGATAAACAGGGAAAATGG - Intronic
1068206098 10:53856110-53856132 GTTTGGGGACTCAGGGGAAAGGG + Intronic
1068556413 10:58464120-58464142 TTTGGGGGACACAGGGATAAGGG - Intergenic
1068749750 10:60578601-60578623 ATTTGAGTCCACAGTGAAATGGG + Intronic
1069287131 10:66729625-66729647 CTTTGGGGACTCAGGGGAAAGGG + Intronic
1069417703 10:68215628-68215650 ATTGGGGATCAGAGGGAAAATGG + Intergenic
1070326429 10:75392495-75392517 ATTTTGGTAGAAAGGGAAAAAGG + Intergenic
1070353960 10:75620994-75621016 CTTTGGGGACACGGGGGAAATGG - Intronic
1070745601 10:78931872-78931894 AATTGGTTAAACAAGGAAAAGGG - Intergenic
1070987119 10:80698644-80698666 ATGTGAGGACACAGGGAGAAGGG - Intergenic
1071056006 10:81508543-81508565 ATTTGGGCAGACAAAGAAAACGG + Intergenic
1071536698 10:86439029-86439051 GTTTGGGGACACAAGGTAAAGGG + Intronic
1071868917 10:89770035-89770057 CTTTGGGTGCAGAGGCAAAATGG - Intronic
1071889947 10:89993490-89993512 TTTTGGGGACTCAGGGGAAAGGG - Intergenic
1071895041 10:90057098-90057120 CTTTGGGGACTCAGGGGAAAAGG + Intergenic
1072454668 10:95565202-95565224 ACCTGGGTCCACAGGGAAACGGG + Intergenic
1072868353 10:99088366-99088388 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1073524390 10:104165847-104165869 ATTTGGGTATACCGAGAAAACGG + Intronic
1073637782 10:105217143-105217165 AACTGGGAACAAAGGGAAAACGG - Intronic
1074006288 10:109427781-109427803 ATTTGGGTGGAGAGGGAACAGGG + Intergenic
1075104430 10:119528917-119528939 ATTTTGGTGCACAGAGAAAATGG + Intronic
1075494286 10:122906342-122906364 GTTTGGGGACGCAGGGAGAAGGG + Intergenic
1075886969 10:125908583-125908605 ACTTGGGGACCCAGGGGAAAGGG + Intronic
1076211064 10:128645389-128645411 ATTTGTGGACACAGTGAGAAGGG - Intergenic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077975801 11:7247258-7247280 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1078952947 11:16155907-16155929 ATTTGGATATTCAGGGAGAAGGG - Intronic
1079260330 11:18872353-18872375 CTTTGGGGACTCAGGGAGAAAGG - Intergenic
1079704621 11:23598720-23598742 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1079896887 11:26130916-26130938 CTTTGGGGACCCAGGGAGAAGGG + Intergenic
1079951702 11:26813676-26813698 CTTTGGGGACTCAGGGGAAAAGG - Intergenic
1080275157 11:30495402-30495424 ATTTGGACACAGAGGGGAAACGG + Exonic
1081070883 11:38606978-38607000 ACTTGGCCACACAGGAAAAAAGG - Intergenic
1081846771 11:46246375-46246397 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1082583897 11:54909955-54909977 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1083127334 11:60583829-60583851 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1085627045 11:78081585-78081607 TTTTGGGTCCACAGATAAAACGG - Intergenic
1085751326 11:79163548-79163570 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1087224176 11:95579457-95579479 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1087735642 11:101829746-101829768 CTTTGGGGACTCAGGGGAAAGGG + Intronic
1088180110 11:107099714-107099736 CTTTGGGGACTCAGGGAGAAAGG + Intergenic
1088401000 11:109422647-109422669 AGTTGGGGGCACAGGGAAATGGG + Intronic
1088937531 11:114418237-114418259 AGTGGGGTAGACAGGGAAAGGGG + Intronic
1089124476 11:116167079-116167101 ATTGTGTCACACAGGGAAAATGG + Intergenic
1089569245 11:119392148-119392170 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1089807164 11:121100999-121101021 TTTTGGGTACAAAGGTAGAAGGG + Intergenic
1090307191 11:125701817-125701839 TTTTAGATACTCAGGGAAAATGG + Intergenic
1090595620 11:128318202-128318224 CTTTGGGGACTCAGGGAGAAGGG - Intergenic
1090705826 11:129335806-129335828 ATGTGGATACACTGGAAAAAGGG - Intergenic
1090753207 11:129765420-129765442 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1091025035 11:132134483-132134505 TTTTGGGGCCTCAGGGAAAAAGG - Intronic
1091069093 11:132546438-132546460 CTTTGGGGACACGGGGGAAAGGG - Intronic
1092059484 12:5536802-5536824 ATGTGAGAACAGAGGGAAAATGG + Intronic
1092059930 12:5540218-5540240 TTTTGGGGACTCATGGAAAAAGG - Intronic
1092628791 12:10357107-10357129 CTTTGGGGACTCAGGGGAAAAGG - Intergenic
1093284474 12:17241433-17241455 CTTTGGGGACTCTGGGAAAAGGG - Intergenic
1093691102 12:22109966-22109988 CTTTGGGGACTCAGGGGAAAGGG + Intronic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1094857535 12:34417416-34417438 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1095380043 12:41580131-41580153 GTTTGATGACACAGGGAAAATGG - Intergenic
1095680917 12:44974473-44974495 CTTTGGGTACTCGGGGAAAAGGG - Intergenic
1095901414 12:47332307-47332329 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1096212957 12:49780358-49780380 AATTGGATAAAAAGGGAAAAAGG - Intergenic
1096587935 12:52635788-52635810 ATTTGGGGACCCAGGGGGAAAGG + Intergenic
1097547253 12:61019402-61019424 ATTTGGAGACTCAGGGGAAAAGG - Intergenic
1097660240 12:62422388-62422410 CTTTGGGGACTCAGGGAGAAAGG + Intergenic
1097674798 12:62588463-62588485 ATTTGGGGACAGGTGGAAAAGGG + Intronic
1098524584 12:71471984-71472006 CTTTGGGGACTCAGGGAAAAGGG + Intronic
1098551337 12:71764613-71764635 ATTTGGGTACTCAAGGAGGAAGG - Intronic
1098740462 12:74167686-74167708 ATTTGGAGACTCAGGGGAAAGGG + Intergenic
1100042281 12:90334815-90334837 ATCTTGGAAAACAGGGAAAATGG + Intergenic
1100456697 12:94758595-94758617 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1100706778 12:97209389-97209411 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1101569798 12:105943243-105943265 ATTTGGGGACTCAGGGGGAAAGG - Intergenic
1101719263 12:107337045-107337067 AACTGGGTACAAAGGGATAATGG - Intronic
1102748983 12:115275670-115275692 CTTTGGGAACTCAGGGAGAAGGG + Intergenic
1102882135 12:116493751-116493773 AAATGGGGAAACAGGGAAAAAGG - Intergenic
1103900155 12:124299512-124299534 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1104135827 12:125937325-125937347 CTTTGGGTACTTAGGGGAAAGGG - Intergenic
1104160684 12:126177325-126177347 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1105315080 13:19251107-19251129 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1106123753 13:26883134-26883156 GTTTGGGTGCACAGGCAACAGGG - Intergenic
1106133193 13:26956149-26956171 ATCAGGGTGCCCAGGGAAAAGGG + Intergenic
1106258803 13:28045998-28046020 TTTTGGTCACACTGGGAAAAGGG + Intronic
1106639548 13:31569088-31569110 ATGCATGTACACAGGGAAAAGGG + Intergenic
1106870762 13:34017228-34017250 ATATGGTTCCAGAGGGAAAACGG - Intergenic
1106899343 13:34338580-34338602 TTTTGGGGACTCAGGGAGAAGGG + Intergenic
1107182777 13:37481207-37481229 ACTGGGGTACACAAAGAAAAAGG - Intergenic
1107251794 13:38372612-38372634 CTTTGGGGACCCAGGGGAAAGGG + Intergenic
1107554421 13:41505007-41505029 CTTTGGGGACTCAGGGGAAAAGG + Intergenic
1107639165 13:42423951-42423973 ATTTGGATACACAGATACAAAGG + Intergenic
1107812501 13:44213766-44213788 GTTTGGGGACTCAGGGGAAAAGG - Intergenic
1108902396 13:55428011-55428033 CTTTGGGGACTCAAGGAAAAGGG + Intergenic
1109150975 13:58847084-58847106 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1109824676 13:67702663-67702685 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1109945825 13:69430246-69430268 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110182263 13:72631770-72631792 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110505086 13:76276462-76276484 CTTTGGGGACTCTGGGAAAAGGG + Intergenic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1110544762 13:76744118-76744140 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1110604803 13:77419499-77419521 CTTTGGGGACACAGGGGGAAAGG - Intergenic
1110755775 13:79172124-79172146 ATTTGGGGACTCAGGGGGAAAGG - Intergenic
1110865873 13:80395516-80395538 ATTTGGTTACACAGAGAAGAGGG + Intergenic
1111115373 13:83769643-83769665 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1111690429 13:91556803-91556825 TTTTGGGGACTCAGGGGAAAGGG + Intronic
1111893169 13:94108364-94108386 CTTTGGGGACTCAGGGAAAAAGG + Intronic
1111898008 13:94165477-94165499 CTTTGGGGACTCAGGGGAAATGG + Intronic
1112273646 13:97995327-97995349 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1112542319 13:100327232-100327254 ATGTGGTTACACTGGGAAAGGGG - Intronic
1112700340 13:102000712-102000734 ATTTGGGAACACAGTGATAATGG - Intronic
1113101391 13:106723277-106723299 ATGTGCGTACACAGGGAGAATGG + Intergenic
1113168049 13:107465829-107465851 ATTTGAGGACACAGCTAAAAGGG - Intronic
1113332813 13:109347037-109347059 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1114372365 14:22103910-22103932 TTTTGGGCTCACAGGGAATAGGG + Intergenic
1114440172 14:22739926-22739948 CTTTGGGTACACATCTAAAAAGG - Intergenic
1114859953 14:26504885-26504907 ATGTGTGTACAAAGGGAAAAGGG + Intronic
1115298073 14:31852842-31852864 ATTTGAGTTCACGGGGGAAAGGG - Intronic
1115456440 14:33609450-33609472 ATTTGGGTTGAAAAGGAAAAAGG - Intronic
1117342189 14:54802034-54802056 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1117823932 14:59680514-59680536 ATTTGGGTTCATTGGGAAATTGG - Intronic
1118161742 14:63297648-63297670 ATTTGTATACACAGTGAAATAGG + Intergenic
1118364683 14:65084529-65084551 TTTTGGCAACACACGGAAAAAGG + Intronic
1118905022 14:70017568-70017590 ACTTGGGGACAGTGGGAAAAAGG + Intronic
1118907446 14:70032968-70032990 GTGTGTGCACACAGGGAAAAAGG - Intergenic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1120026729 14:79594397-79594419 ATTTGGGGACAGAGAAAAAAAGG + Intronic
1120541743 14:85759559-85759581 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1121529827 14:94644440-94644462 AGTTGGGAACACAGAAAAAAAGG - Intergenic
1122111552 14:99506826-99506848 ACTTAGGTAGACATGGAAAATGG + Exonic
1124887626 15:33701715-33701737 GTTTGGGAGCACACGGAAAAGGG + Intronic
1125102802 15:35934335-35934357 CTTTGGGGACTCAGGGAGAAGGG + Intergenic
1125163917 15:36680165-36680187 ATCTGGGAAGCCAGGGAAAAGGG - Intronic
1125228482 15:37424555-37424577 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1126540842 15:49821554-49821576 CTTTGGGGACTCAGGGAGAAAGG - Intergenic
1126624518 15:50673427-50673449 CTTTGGGGACTCAGGGAGAAAGG - Intronic
1127226464 15:56935633-56935655 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1127227474 15:56947871-56947893 ATTTGGGTGCACAGCCTAAATGG + Intronic
1128255645 15:66194649-66194671 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1128554077 15:68618458-68618480 ATTTGAGTAAACAGGAAAAGGGG + Intronic
1129003574 15:72353829-72353851 ATTTGGGTACACAGGGAAAATGG + Intronic
1129053711 15:72804950-72804972 TTTTGAGGACACAGGGCAAAAGG + Intergenic
1129643519 15:77408374-77408396 CTTTGGGGACACAGGGGGAAGGG + Intronic
1130012412 15:80161857-80161879 ATTTGAATACACAGGGACAAGGG + Intronic
1132334629 15:101038203-101038225 TTTTGGGGACTCAGGGGAAAGGG + Intronic
1133595025 16:7282738-7282760 CTTTGGGGACTCAGGGAGAAAGG - Intronic
1133748903 16:8709254-8709276 CTTTTGGAACACATGGAAAAAGG - Intronic
1133836076 16:9368435-9368457 CTTTGGGAACTCAGGGGAAAGGG - Intergenic
1136140241 16:28283689-28283711 ATGTGGGTACCCAGAGGAAACGG + Intergenic
1137368581 16:47883224-47883246 CTTTGGGCACTCAGGGAGAAAGG + Intergenic
1138631996 16:58303890-58303912 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1139000962 16:62509334-62509356 ATTAGGGTATACATGGAAACAGG + Intergenic
1139808740 16:69593638-69593660 TTTTGAGAACACAGGTAAAAGGG + Intronic
1140829411 16:78737592-78737614 CTTTGGGAACTCAGGGAGAAGGG - Intronic
1140907859 16:79425073-79425095 CTTTGGGTATATGGGGAAAAAGG - Intergenic
1142415756 16:89940648-89940670 GTTTGGGAACTCAGGGGAAAGGG - Intergenic
1142910305 17:3083670-3083692 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1143278125 17:5729877-5729899 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1143303509 17:5928318-5928340 ATATGGGGACACAGGAAGAAAGG - Intronic
1143434996 17:6917457-6917479 ATTTGGGGACTCAGGGGGAAAGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144616603 17:16781099-16781121 CTTTGGGGACTCAGGGGAAATGG + Intronic
1145768744 17:27477577-27477599 ATCTGTCTACATAGGGAAAACGG + Intronic
1145895488 17:28455310-28455332 ATTTGGGCAAGCAAGGAAAAAGG + Intergenic
1149291372 17:55220825-55220847 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1149392901 17:56209825-56209847 CTTTGGGCACTCAGGGGAAAAGG - Intronic
1149967690 17:61182628-61182650 ATATGGGAACACAGGGTAATAGG - Intronic
1150501056 17:65651095-65651117 CTTTGGGGACTCAGGGAGAAAGG - Intronic
1150911497 17:69392396-69392418 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1151111629 17:71684655-71684677 CTTTGGGGACACCGGGGAAAGGG - Intergenic
1151201816 17:72474136-72474158 CTTTGGGGACGCGGGGAAAAGGG + Intergenic
1153189623 18:2523289-2523311 AGTTGGGTAAAAAGGGAAGAAGG + Intergenic
1153220697 18:2858319-2858341 CTTTGGGGACTCAGGGGAAAAGG - Intronic
1154350043 18:13575232-13575254 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1155433185 18:25783357-25783379 ATGTGGGGACTCAGGGAAAAGGG - Intergenic
1156164282 18:34399327-34399349 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1156939525 18:42748748-42748770 TTTTGGGGACTCAGGGGAAAGGG + Intronic
1157144478 18:45147759-45147781 CTTTGGGGACTCAGGGAAAGGGG - Intergenic
1157993998 18:52533129-52533151 ATTGGGGGAAACAGGGTAAAGGG - Intronic
1159540897 18:69774339-69774361 CTTTGGGGACTCAGGGGAAAAGG + Intronic
1160075046 18:75666762-75666784 TATTGGGAACACAGGGAAAATGG + Intergenic
1160180214 18:76628147-76628169 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1161225043 19:3140231-3140253 ATTTGATAACACAGGCAAAATGG - Intronic
1161673953 19:5632286-5632308 ATTTGGGGACTCTGGGTAAAGGG - Intronic
1161752604 19:6109313-6109335 ATATGGGGTCACAGGGAGAAGGG + Intronic
1162211424 19:9095113-9095135 ATTTGAGGACACAGCGAAAGGGG + Intergenic
1164267953 19:23639225-23639247 CTTTGGGGATACAGGGAGAAAGG + Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1165662814 19:37597212-37597234 GTTTGGGTACTGAGGGAGAAGGG + Intronic
1165700433 19:37933155-37933177 ATGAGGTCACACAGGGAAAATGG - Intronic
1166400555 19:42476248-42476270 ATTTGTGACCACAGGAAAAAGGG - Intergenic
1166416454 19:42597994-42598016 TTTTGGGGACTCAGGTAAAAAGG - Intronic
1167550752 19:50159162-50159184 ATTTGGGGAGACAGGGTGAAGGG + Intronic
1167713970 19:51128978-51129000 ATTTGTTTACACAGGGTATATGG - Intronic
1167960255 19:53099284-53099306 ATTTGGGGACATAGGGTAAGAGG + Intronic
925239782 2:2314427-2314449 ATTTGGATACATGGGGAAAAAGG - Intronic
925476669 2:4224223-4224245 ATGATGATACACAGGGAAAAAGG - Intergenic
925483861 2:4305971-4305993 TTTTGGGGACTCAGGGGAAAGGG + Intergenic
925665705 2:6252988-6253010 CTTTGGGGACTCAGGGAAACGGG - Intergenic
925706547 2:6689811-6689833 CTTTGGGGACTCAGGTAAAAGGG + Intergenic
925961714 2:9023388-9023410 ATTTGGGGACTCAGGGAGAAGGG + Intergenic
926402999 2:12518878-12518900 ATTTGGGTCAAAAGGGAAAGTGG - Intergenic
927437579 2:23082661-23082683 ACTTGAGTCCACAGGAAAAAAGG - Intergenic
930209349 2:48618120-48618142 GTTTGGGTAAAAAGAGAAAAAGG - Intronic
930423538 2:51183468-51183490 CCTTGGGTACTCAGGGGAAAGGG + Intergenic
930474569 2:51864865-51864887 CTTTGGGGACTCGGGGAAAAAGG - Intergenic
930927590 2:56838208-56838230 CTTTGGGGAAACAGGGGAAAGGG + Intergenic
931136469 2:59407650-59407672 CTTTGGGGACTCAGGGGAAAAGG + Intergenic
931496991 2:62818788-62818810 ATTTGGGAACAAAGGAGAAAAGG + Intronic
931513080 2:63021743-63021765 ATTTGGGGAAACTGGGAGAAAGG - Intronic
933025721 2:77256161-77256183 ATTTGACAACACAGGTAAAATGG + Intronic
935043659 2:99459317-99459339 ATTTGGGGAAACTGGGTAAAGGG + Intronic
935480032 2:103575659-103575681 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
935924997 2:108058355-108058377 AATTGGAAACACAAGGAAAAAGG + Intergenic
936555340 2:113492477-113492499 CTTTGGGGACTCAGGGAGAAAGG + Intronic
936930627 2:117784881-117784903 ATGTGAGGACACAGGGAGAAGGG + Intergenic
937685309 2:124689858-124689880 TATTGGGCACACAGGCAAAATGG - Intronic
937722561 2:125120396-125120418 CTTTGGGGACTCAGGGAGAAAGG - Intergenic
938563778 2:132498245-132498267 CTTTGGGGACTCAGGGTAAAGGG - Intronic
938677843 2:133656929-133656951 CTTTGGGTACTCAGGGGAAAGGG - Intergenic
939757427 2:146131138-146131160 GTTAGGGGACACATGGAAAACGG - Intergenic
939839639 2:147171626-147171648 ATTGTGGTACACAGGGCATACGG + Intergenic
940132942 2:150405090-150405112 CTTTGGGTACACAGAGATATTGG + Intergenic
940141773 2:150499387-150499409 CTTTGGGGACTCAGGGGAAAGGG - Intronic
941104735 2:161340302-161340324 AGTGGGGTTCCCAGGGAAAAGGG + Intronic
941229979 2:162899678-162899700 TTTTGGGGACTCAGGGGAAAAGG - Intergenic
941393324 2:164943602-164943624 ATTTGACTACAAAGGGAAATGGG + Intronic
941473699 2:165921982-165922004 CTTTGGGGACTCAGGGGAAAGGG - Intronic
941630824 2:167882616-167882638 ATTTGGGTACACAGGGATGTGGG - Intergenic
942434016 2:175951375-175951397 CTTTGGGGACTCAGGGGAAAGGG - Intronic
942553461 2:177145974-177145996 ATTTGGGCACCCAGGCAAAGAGG + Intergenic
943654778 2:190496894-190496916 CTTTGGGGACTCAGGGGAAAGGG + Intronic
944762482 2:202831282-202831304 ATTTGGGTACCTAGGGAGCATGG + Intronic
944893166 2:204138154-204138176 ATTTGTGTTCAAAGGGACAAGGG + Intergenic
945297424 2:208184287-208184309 ATATGTGTACACAGAGAATAAGG + Intronic
945387480 2:209220177-209220199 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
946733724 2:222733626-222733648 ATTTGGGTAAACAGGTAAAGAGG - Intergenic
947438468 2:230094512-230094534 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
948779892 2:240312610-240312632 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1170125627 20:12960309-12960331 CTTTGGGGACACAGGGGGAAAGG + Intergenic
1170772580 20:19346675-19346697 CTTTGGGAACTCAGGGGAAAGGG + Intronic
1170781224 20:19427312-19427334 ACTCGGACACACAGGGAAAATGG + Intronic
1173563999 20:44026448-44026470 CTTTGGGGACTCAGGGAGAAAGG + Intronic
1174163426 20:48567789-48567811 AGTTGGATTCACAAGGAAAAGGG + Intergenic
1174680193 20:52399209-52399231 CTTTGGGGACTCGGGGAAAAGGG + Intergenic
1174769853 20:53288973-53288995 CTTTGGGGACTCAGGGCAAAGGG - Intronic
1174946233 20:54988661-54988683 ATTTGAGAACACAAGGAAATTGG - Intergenic
1175645304 20:60665920-60665942 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1176931726 21:14820213-14820235 ATTTGAGTAAATAGGGAAAGCGG + Intergenic
1177072913 21:16533398-16533420 ATGTGTTTACACATGGAAAAGGG + Intergenic
1177501294 21:21959526-21959548 ATTTGGAGACTCAGGGAAAAGGG + Intergenic
1177528617 21:22331721-22331743 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1177661641 21:24091446-24091468 CTTTGGGGACACAGGAGAAAGGG + Intergenic
1177849477 21:26329537-26329559 ATGAGGACACACAGGGAAAAGGG - Intergenic
1177882602 21:26711784-26711806 CTTTGGGGACTCAGGGGAAATGG - Intergenic
1177957947 21:27624240-27624262 ATTTGATTACACAAAGAAAATGG + Intergenic
1178508368 21:33181448-33181470 CTTTGGGGACTCAGGGGAAATGG + Intergenic
1178984830 21:37294058-37294080 ATTTGTGTCCTCAGTGAAAAAGG + Intergenic
1183766589 22:39882317-39882339 AGTTGGGGATAGAGGGAAAAAGG + Intronic
1184440458 22:44509577-44509599 CTTTGGGGACTCAGGGGAAAAGG + Intergenic
1184836609 22:47027490-47027512 CTTTGGGGACTCAGGGGAAAAGG - Intronic
950166862 3:10807554-10807576 CTGTGAGGACACAGGGAAAAAGG - Intergenic
950840257 3:15961614-15961636 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
950924004 3:16722007-16722029 ATTTGGAAACACAGGGAAAGGGG + Intergenic
952083357 3:29787670-29787692 CTTTGGGGACTCAGGGAAAAAGG + Intronic
952580340 3:34825192-34825214 CTTTGGGGACTCAGGGAGAAGGG + Intergenic
953244688 3:41179998-41180020 ATTTGAGTAAACAGGGAATAGGG + Intergenic
953581706 3:44163133-44163155 TTTTGGGTACACAGGAAGAATGG + Intergenic
953616398 3:44494269-44494291 ATTTGAGGACACAGGAAAAAGGG + Intergenic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954497989 3:50983163-50983185 CTTTGGGTACACAGGGGGTAGGG + Intronic
956194239 3:66636137-66636159 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
956240841 3:67128459-67128481 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
956537681 3:70296211-70296233 ATTTGGGGGCTCATGGAAAAAGG - Intergenic
958014297 3:87920234-87920256 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
958756679 3:98258088-98258110 TTTTGGGGACTCAGGGGAAAGGG - Intergenic
958861394 3:99449063-99449085 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
959010647 3:101071582-101071604 ATTTGTGGACACATAGAAAAAGG - Intergenic
959347628 3:105219167-105219189 CTTTGGGGACTCAGGAAAAAGGG - Intergenic
959480097 3:106861469-106861491 ATTTGGGGACTCAGGGGAAAGGG + Intergenic
959777437 3:110184328-110184350 ATTTAGGTATACAAAGAAAAAGG - Intergenic
959980429 3:112510230-112510252 CTTTGGGGACTCTGGGAAAAGGG + Intergenic
960526380 3:118715965-118715987 ATTTGGGGACACTGGGCAAAGGG - Intergenic
960891270 3:122450978-122451000 CTTTGGGGACTCAGGGAGAAAGG + Intronic
961197213 3:125012812-125012834 ATGTGGGTACACTGGTCAAAGGG + Exonic
963574787 3:147046456-147046478 ATTTTGGGACACAGGAGAAATGG - Intergenic
964017815 3:151968792-151968814 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
964342165 3:155719173-155719195 CTTTGGGGACTCAGGGGAAAGGG - Intronic
965637621 3:170800267-170800289 CTTTGGGGACTCAGGGGAAAGGG - Intronic
965655961 3:170985114-170985136 ATGTGAGTACACTGGGAGAAGGG + Intergenic
966220943 3:177550472-177550494 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
966541599 3:181097274-181097296 ATTTTGGTACTTAAGGAAAATGG + Intergenic
967996761 3:195172816-195172838 ATTTGGGGAAAGAGGGCAAAGGG + Intronic
968173673 3:196530064-196530086 CTTTGGGTATTCAGGGGAAAGGG - Intergenic
969089408 4:4682507-4682529 ATGTGAGGACACAGGGAGAAGGG - Intergenic
969546635 4:7834342-7834364 CTTTGGGGATTCAGGGAAAAAGG + Intronic
969810593 4:9644597-9644619 ATTTGGGTAGGGAAGGAAAAAGG - Intergenic
970848224 4:20569303-20569325 ATTGGTTTGCACAGGGAAAATGG - Intronic
970917513 4:21352829-21352851 GTTTGGGTACACTGGGATCAGGG - Intronic
971431500 4:26572766-26572788 CTTTGGGGACTCAGGGAGAAAGG - Intergenic
971545691 4:27882200-27882222 AGTTGGGAAAACAGGGAAACTGG - Intergenic
971781932 4:31047135-31047157 ATTTGTGTAATCAGAGAAAAAGG - Intronic
971921751 4:32949524-32949546 CTTTGGGGACTCAGGGAAATGGG + Intergenic
972800361 4:42468659-42468681 CTTTGGGGACTCAGGGGAAAGGG + Intronic
973232835 4:47862031-47862053 ATTTGGGTAGACATTTAAAAAGG - Intronic
974105630 4:57466816-57466838 CTTTGGGGACTCTGGGAAAAGGG - Intergenic
974215932 4:58847604-58847626 ATTTGGGGACTCAAGGGAAAAGG - Intergenic
974583212 4:63834331-63834353 CTTTGGGAACTCAGGGGAAAAGG - Intergenic
974815708 4:67000814-67000836 CTTTGGGGACTCAGGGGAAAAGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976656365 4:87492743-87492765 ATTTTGGTACACAAGGTCAATGG - Intronic
976726279 4:88218603-88218625 CTTTGGGGACTCAGGGGAAAGGG - Intronic
977637788 4:99320205-99320227 CTTTGGGGACTGAGGGAAAAGGG - Intronic
977645381 4:99405883-99405905 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
977826557 4:101539313-101539335 CTTTGGGGACTCAGGGCAAAGGG + Intronic
978381858 4:108137248-108137270 CTTTGGGGACTCAGGGGAAAGGG + Intronic
978726023 4:111970532-111970554 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
978782692 4:112573386-112573408 CTTTGGGGACTCAGGGGAAAGGG + Intronic
978875558 4:113636660-113636682 ATTTGAGTTCACAGTGACAAGGG - Intronic
978923987 4:114220184-114220206 CTTTGGGGACTCAGGGGAAAAGG - Intergenic
980034534 4:127868643-127868665 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
980128389 4:128795199-128795221 ATTGGGGGAAACAGGGTAAATGG - Intergenic
980263507 4:130485096-130485118 CTTTGGGGACACAGGGGGAAAGG + Intergenic
980474217 4:133290901-133290923 GTTTGGGCAAACAGGGGAAAAGG - Intergenic
980569731 4:134598675-134598697 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
980586383 4:134821948-134821970 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
981156261 4:141440476-141440498 ATTTGGCTACATGGGAAAAAAGG - Intergenic
982451544 4:155558327-155558349 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
982864570 4:160493776-160493798 ACGTGGGTACACAGAGTAAAGGG - Intergenic
983245851 4:165285854-165285876 ATTAGGATACAAAGGGAACACGG + Intronic
983358473 4:166696887-166696909 ATTTGGGGCCTGAGGGAAAAGGG - Intergenic
983369471 4:166840447-166840469 CTTTGGCTACAAAGAGAAAAGGG + Intronic
983845140 4:172508563-172508585 ATTTGGGGACTCAGGGAGAAGGG - Intronic
985443838 4:190008057-190008079 CTTTGGGGACTCAGGGAGAAAGG + Intergenic
986357890 5:6946860-6946882 ATTTGGAGACTCAGGGAACAGGG + Intergenic
986582589 5:9280646-9280668 ATTTTGGTACATAGGCAAATTGG + Intronic
986598121 5:9444347-9444369 CTTTGGGGACTCAGGGGAAAGGG - Intronic
987333622 5:16878815-16878837 CTTTGGGGACTCAGGGAGAAGGG + Intronic
987786553 5:22507984-22508006 ATTTGAATACACAGAGGAAAAGG - Intronic
987947897 5:24637188-24637210 ACTTGGGAAGACAGGGAAAGAGG - Intronic
988623581 5:32847846-32847868 ATTTGGATTCACAGGGACCAGGG + Intergenic
988724623 5:33913992-33914014 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
988876378 5:35451462-35451484 CTTTGGGAACTCAGAGAAAAGGG + Intergenic
990112844 5:52349273-52349295 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
990358304 5:54992917-54992939 CTTTGGGGACTCAGGGGAAAGGG + Intronic
990746842 5:58967256-58967278 ATGTGGGAACACAGGGAAAGAGG - Intergenic
990950148 5:61290538-61290560 CTTTGGGGACTCAGGGAGAAAGG - Intergenic
991038284 5:62150078-62150100 ATGTGAGGACACAGGGAGAAGGG - Intergenic
992337220 5:75784189-75784211 ATTTGAGAATTCAGGGAAAAGGG + Intergenic
992613722 5:78530438-78530460 ATTTGTCTACACACGGAACAGGG + Intronic
993441928 5:87967805-87967827 ATTTGGGGACTCAGGGGGAAAGG + Intergenic
993505562 5:88704894-88704916 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
993743759 5:91570505-91570527 TTTTGGGGACTCAGGGGAAAGGG + Intergenic
994489108 5:100419166-100419188 ATTTGGGTAGACAGGGCAAAGGG + Intergenic
994739788 5:103603524-103603546 TTTGGAGTACACAGGGAAAGAGG - Intergenic
994822040 5:104665446-104665468 ATTTGAGTCCAAAGGAAAAAAGG - Intergenic
995569074 5:113460250-113460272 ATTTGTGGACACAAGAAAAAGGG + Intronic
997150953 5:131494572-131494594 TCTAGGGTACACAGGAAAAAGGG + Intronic
997851054 5:137332924-137332946 ATGAGGTTACCCAGGGAAAATGG + Intronic
997996040 5:138587282-138587304 ATTTGGATTCACAGGGTAAGTGG - Intergenic
998514286 5:142738517-142738539 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
999275415 5:150326687-150326709 ATTGGGACACACAGGGACAAAGG + Intronic
999744419 5:154580914-154580936 ATTTTGATACACAGGGATTAAGG - Intergenic
999785441 5:154885876-154885898 AATAGGGTAGACAGGGAAGAAGG - Intergenic
1000405692 5:160886234-160886256 ACATGGGTGCACAGAGAAAATGG + Intergenic
1001733223 5:173975498-173975520 CTTTGGGAACTCAGGGGAAAGGG - Intronic
1003252249 6:4440304-4440326 CTTTGGGGACTCAGGGAAAAAGG - Intergenic
1003466032 6:6380898-6380920 ATGTGAGGACACAAGGAAAAAGG + Intergenic
1003771827 6:9313291-9313313 ATTTGCACACACAGGGGAAAGGG - Intergenic
1004016237 6:11734525-11734547 ATTTGGGTACTCAGGGAAAGAGG + Intronic
1004420454 6:15464867-15464889 ATATGGGGACACAGGAAAAAAGG - Intronic
1004938737 6:20533480-20533502 ATATGGATAAACAGAGAAAAGGG + Intergenic
1004971686 6:20917657-20917679 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1005305304 6:24507942-24507964 CTTTGGGGACTCAGGGAGAAAGG - Intronic
1005767175 6:29023599-29023621 CTTTGGGGACTCGGGGAAAAGGG - Intergenic
1007864704 6:44955710-44955732 ATTTGGGGACTCAGGGGAAAGGG + Intronic
1008061852 6:47006684-47006706 CTTTGGGGACTCAGGGGAAAAGG - Intronic
1008245342 6:49164419-49164441 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1008483092 6:52006848-52006870 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1009392174 6:63157311-63157333 CTTTGGGGACTCAGGGGAAAAGG + Intergenic
1009394222 6:63178595-63178617 ATTAGGGTACACAGAGGACAGGG - Intergenic
1009905890 6:69868860-69868882 ATGTGGGTACACAGAGTCAATGG + Intronic
1010928535 6:81772754-81772776 ATTTGGGTTTAGGGGGAAAATGG + Intergenic
1010962245 6:82158537-82158559 CTTTGGGGACTCAGGGAGAAGGG + Intergenic
1011156107 6:84334758-84334780 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1012183221 6:96181585-96181607 CTTTGGGTACTCAGGGAGAAAGG - Intronic
1012656195 6:101824292-101824314 ATTTGGGAACTTAGGGGAAAGGG - Intronic
1012717097 6:102689034-102689056 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1013954321 6:115822908-115822930 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1014309891 6:119786915-119786937 ATTTGGGAAGATGGGGAAAAGGG + Intergenic
1014419920 6:121230945-121230967 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1015016993 6:128425412-128425434 CTTTGGGGACTCGGGGAAAAGGG - Intronic
1015094628 6:129400127-129400149 ATGTGAGGACACAGTGAAAACGG - Intronic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1016770927 6:147849900-147849922 ATTCTGGCACACAGGGACAAAGG + Intergenic
1016864738 6:148754465-148754487 CTTTGGGGACTCAGGGAGAAAGG - Intronic
1016903672 6:149128198-149128220 ATTGGGGTAAACTGGGTAAAGGG + Intergenic
1017555859 6:155567459-155567481 CTTTGAGAACTCAGGGAAAAGGG - Intergenic
1018349150 6:162938056-162938078 CCTTGGGGACACAGGGGAAAAGG - Intronic
1019765337 7:2845418-2845440 CTTTGGGGACTCAGGGTAAAAGG - Intergenic
1020403150 7:7800596-7800618 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1020595146 7:10197588-10197610 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1020635383 7:10690611-10690633 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1020657759 7:10948093-10948115 ATTAGGGGACACAGTCAAAAAGG + Intergenic
1022039849 7:26570378-26570400 ATTTGGGGAAACAGGGTCAAGGG + Intergenic
1022355804 7:29613345-29613367 ATTTGGATACAAAGGGAAGAAGG + Intergenic
1022519354 7:30995925-30995947 ATCTGGGCACACAGGGAGACAGG + Intergenic
1022605916 7:31813814-31813836 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1023537430 7:41228179-41228201 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1024160161 7:46665950-46665972 CTTTGGGGACTCAGGGGAAATGG - Intergenic
1024665085 7:51538100-51538122 CTTTGGGGACACAGGGGGAAGGG - Intergenic
1024767765 7:52681238-52681260 GTTTGGGTACACAAAGAAATTGG + Intergenic
1025574293 7:62616459-62616481 ATTGAGGTTTACAGGGAAAAAGG - Intergenic
1026218730 7:68372985-68373007 CTTTGGGGACACGGGGGAAAGGG - Intergenic
1027471370 7:78578405-78578427 AGTTGTGTGGACAGGGAAAATGG + Intronic
1028198277 7:87932711-87932733 ACTTGGGGACTCAGGGGAAAGGG + Intergenic
1028462481 7:91111206-91111228 ATTTGGGTAGAGAAGGAAAAAGG - Intronic
1028726908 7:94098123-94098145 CTTTGGAAACTCAGGGAAAAGGG + Intergenic
1029056203 7:97745558-97745580 CTTTGGGAAGCCAGGGAAAAAGG + Intergenic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1030425635 7:109373753-109373775 ATTTGGGTACTCGGGGGAAAGGG - Intergenic
1031089990 7:117342886-117342908 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1031225259 7:119028949-119028971 ATGTGGGTACACTGGACAAAGGG - Intergenic
1031232012 7:119119832-119119854 ATTTGGGGACTTAGGGGAAAGGG - Intergenic
1031878647 7:127170825-127170847 CTTTGGGGACTCAGGGGAAAGGG + Intronic
1031996691 7:128236946-128236968 AAGTGGCTACACAGAGAAAAGGG - Intergenic
1032257762 7:130310944-130310966 ATATGGGTACTCAGTCAAAAAGG + Exonic
1032911804 7:136440866-136440888 CTTTGGGGACTCAGGGGAAATGG - Intergenic
1033212299 7:139468973-139468995 ATGTGAGGACACAGGGAGAAGGG + Intronic
1033651461 7:143346673-143346695 GTTTGGGGATACAGGGGAAAGGG + Intronic
1033767308 7:144507689-144507711 ATTTCGGAATACAGGAAAAAAGG - Intronic
1033861350 7:145631765-145631787 CTTTGGGCACTCAGGGGAAAAGG - Intergenic
1033890497 7:146006864-146006886 CTTTGGGGACACAGGGGAAAGGG + Intergenic
1033961087 7:146913911-146913933 CTTTGGGGACTCAGGGGAAAGGG - Intronic
1034118350 7:148604542-148604564 CTTTGGGGACTCAGGGGAAAGGG + Intronic
1034216239 7:149408375-149408397 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1035132507 7:156669023-156669045 ATTTGGTTACATAGGGTAAGTGG + Intronic
1035331693 7:158100038-158100060 CTTTGGAGACTCAGGGAAAAGGG - Intronic
1036555804 8:9859436-9859458 CTTTGGGGACCCAGGGGAAAGGG + Intergenic
1037055269 8:14432512-14432534 CTTTGGGGACTCAGGGTAAAGGG + Intronic
1037123076 8:15313448-15313470 CTTTGGGGACTCAGGGCAAAGGG + Intergenic
1038875984 8:31550029-31550051 ATTTGGTTTTAAAGGGAAAATGG - Intergenic
1039144354 8:34429537-34429559 CTTTGGTTTCACATGGAAAAAGG - Intergenic
1039572509 8:38599069-38599091 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1039660748 8:39461494-39461516 CTTTGGGGACTCAGGGGAAAAGG + Intergenic
1039760847 8:40573445-40573467 ATTTGGATACACAGAGAAGAAGG - Intronic
1040683297 8:49839723-49839745 ATTTGGGTCTACAAGGAATATGG - Intergenic
1041150784 8:54931356-54931378 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1041212530 8:55567189-55567211 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1041832486 8:62170523-62170545 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1041926808 8:63245457-63245479 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1041985483 8:63917631-63917653 CTTTGGGGACACAGGGGGAAAGG - Intergenic
1042145506 8:65724768-65724790 ATTTGGTTTTACAGGTAAAATGG - Exonic
1043660429 8:82734597-82734619 ATTTAGGTATTTAGGGAAAATGG - Intergenic
1043691621 8:83160474-83160496 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1043862239 8:85333278-85333300 AAATGTGTTCACAGGGAAAAAGG - Intronic
1045059537 8:98399974-98399996 ATTTGGGATCAGAGGGGAAAAGG - Intergenic
1045850131 8:106686109-106686131 CTTTGGGGACTCAGGCAAAAGGG + Intronic
1045976232 8:108132967-108132989 ATTTGGGGAAACAGTGGAAATGG - Intergenic
1046288630 8:112129280-112129302 ATTTGGAAAAAAAGGGAAAATGG - Intergenic
1046556141 8:115775748-115775770 ATTTGGGAACACCAGCAAAAAGG + Intronic
1046633243 8:116643299-116643321 ATTTGGCAATACAGGTAAAAGGG + Exonic
1047414968 8:124657044-124657066 ATTTGAGTCAACTGGGAAAATGG + Intronic
1047593638 8:126353873-126353895 CTTTGGGAACTCAGGGGAAAGGG + Intergenic
1047606824 8:126482901-126482923 CTTTGGGAACTCAGGGGAAATGG - Intergenic
1047649506 8:126904681-126904703 ATTTGGGTACACATGGACTGAGG + Intergenic
1048467686 8:134680873-134680895 TTTTGGGTAAACTGGGTAAAAGG + Intronic
1049034536 8:140064030-140064052 AAATGGCTACACAGAGAAAAAGG - Intronic
1049897654 9:124711-124733 CTTTGGGGACTCAGGGAGAAAGG - Intronic
1050074815 9:1852583-1852605 ATTGTGGTACAAAAGGAAAAAGG + Intergenic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1050441550 9:5669290-5669312 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1051311213 9:15774938-15774960 CTTTGGGGACTCAGGGGAAAGGG + Intronic
1051890979 9:21942616-21942638 ATGTGGGGACACAGTGACAAGGG + Intronic
1052219535 9:26002637-26002659 CTTTGGGGACTTAGGGAAAAGGG + Intergenic
1052744186 9:32423738-32423760 CTTTGGGGACTCAGGGCAAAGGG + Intronic
1052747872 9:32458707-32458729 ATTTGGGGAAACTGGGTAAAGGG - Intronic
1052894772 9:33736708-33736730 CTTTGGGGACTCAGGGAGAAAGG + Intergenic
1053740745 9:41134999-41135021 CTTTGGGGACTCAGGGAGAAAGG - Intronic
1054443734 9:65291154-65291176 CTTTGGGGACTCAGGGAGAAAGG - Intergenic
1054486540 9:65730349-65730371 CTTTGGGGACTCAGGGAGAAAGG + Intronic
1054687605 9:68296300-68296322 CTTTGGGGACTCAGGGAGAAAGG + Intronic
1054702064 9:68422881-68422903 CTTTGGGGACACGGGGGAAAGGG - Intronic
1055138423 9:72850208-72850230 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1055198389 9:73625610-73625632 ATTTGGTAACACACAGAAAATGG + Intergenic
1055572988 9:77635177-77635199 TTTTTGGGACTCAGGGAAAATGG - Intronic
1055711825 9:79071731-79071753 CTTTGGGGACTCAGGGTAAATGG + Intergenic
1055866905 9:80825528-80825550 CTTTGGGGACTCAGGGGAAAGGG + Intergenic
1055884445 9:81043962-81043984 CTTTGAGTACACAGAGAAAGGGG + Intergenic
1056712200 9:89000215-89000237 ATTTGGGAACACAGCGAGAGAGG - Exonic
1057488427 9:95504789-95504811 ATTTGGGTTCACAGCTGAAATGG - Intronic
1059441549 9:114310105-114310127 ATTTGAGGACTTAGGGAAAAGGG + Intronic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1060294375 9:122333324-122333346 AGTTTGGTACAAGGGGAAAAGGG - Intergenic
1060871528 9:127045463-127045485 ATTCCAGTACACAGGGATAATGG - Intronic
1186310859 X:8317102-8317124 AAATGAGTACACTGGGAAAAAGG + Intergenic
1186371683 X:8953308-8953330 ATTTGAGAACACAGCGAAAGAGG - Intergenic
1187215333 X:17270306-17270328 ATTTGGTTTTACAGAGAAAAAGG - Intergenic
1187600007 X:20818735-20818757 ATTTGGGGACTCGGGGGAAAGGG + Intergenic
1188816514 X:34721653-34721675 CTTTGGGGACTCAGGGGAAAAGG - Intergenic
1189128792 X:38477171-38477193 CTTTGGGGACACAGGGGAAAGGG - Intronic
1189195545 X:39149179-39149201 ATTTTGGTGCACACTGAAAATGG - Intergenic
1189381815 X:40507533-40507555 ATTTGGGGAAGCAAGGAAAAAGG - Intergenic
1190449497 X:50564165-50564187 ATTGGGGTACACAGGGTATTTGG - Intergenic
1190967442 X:55314040-55314062 CTTTGGGGACTCAAGGAAAAGGG - Intergenic
1191268757 X:58434023-58434045 ATTGGGGTCAACAGTGAAAAAGG - Intergenic
1191629187 X:63302735-63302757 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1192231887 X:69271030-69271052 ATTTGGGGACTCGGGGGAAAGGG - Intergenic
1192444436 X:71200015-71200037 TTGTGGGAACACAGGTAAAAAGG - Intergenic
1192603268 X:72487013-72487035 ATGTGGGTCCACAGGCAAAGGGG + Intronic
1192686637 X:73313706-73313728 CTTTGGGGACTCAGGGCAAAAGG - Intergenic
1193007005 X:76631179-76631201 CTTTGGGTACTCTGGGAAAAGGG - Intergenic
1193281758 X:79659377-79659399 CTTTGGGGACACAGGGGAAAGGG - Intergenic
1193469484 X:81881963-81881985 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1193895258 X:87107031-87107053 ATTTTGTTTCACATGGAAAATGG - Intergenic
1194094835 X:89626488-89626510 CTTTGGGGACACAGGGGCAAGGG - Intergenic
1194454254 X:94082579-94082601 CTTTGGGCACTCAGGGGAAAGGG + Intergenic
1194601802 X:95930520-95930542 ATTTGGGGAATCAGGGGAAATGG + Intergenic
1195015451 X:100775210-100775232 CTTTGGGGACTCAGGGGAAAAGG + Intergenic
1195066319 X:101241377-101241399 ATTTGGGGAAACTGGGTAAAGGG + Intronic
1195614045 X:106898892-106898914 GTTTAGCTACAAAGGGAAAAGGG - Intronic
1195992598 X:110697379-110697401 ATTTGGGGAAACTGGGCAAAGGG + Intronic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1196936071 X:120732290-120732312 ATTGGGGGAAACCGGGAAAATGG + Intergenic
1196991694 X:121336250-121336272 ATTTGGGGACAGAGGAAAACAGG + Intergenic
1197145014 X:123162157-123162179 CTTTGGGGACTCAGGGAGAAAGG - Intergenic
1197306972 X:124854338-124854360 CTTTGGGGACTCAGGGGAAAGGG + Intronic
1197392844 X:125889764-125889786 CTTTGGGGACTCAGGGGAAAGGG - Intergenic
1198202478 X:134435787-134435809 ACTTGGGAACACAGGTACAAGGG - Intergenic
1198411421 X:136373273-136373295 ATTTGGGGTCACAGGGCCAAAGG - Intronic
1198472780 X:136964563-136964585 ATGTGAGGACACAGGGATAAAGG - Intergenic
1198910274 X:141605989-141606011 ACTTGGGTACAAAGAGAAGATGG + Intronic
1199928194 X:152491624-152491646 CTTTGGGGACTCAGGGAGAAAGG - Intergenic
1201678155 Y:16611318-16611340 CTTTGGGGACTCAGGGAGAAAGG + Intergenic
1202602607 Y:26609670-26609692 ATTTGTGATCAAAGGGAAAATGG - Intergenic