ID: 1129004552

View in Genome Browser
Species Human (GRCh38)
Location 15:72361355-72361377
Sequence CCTGGGTAACATTAGTACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129004552 Original CRISPR CCTGGGTAACATTAGTACAT TGG (reversed) Intronic
915036556 1:152932425-152932447 TGTGGTTAACAATAGTACATTGG + Intergenic
915914085 1:159930867-159930889 CCTGGGAGACATGAGGACATGGG + Exonic
918134330 1:181658313-181658335 CATGGGAAACAGTTGTACATTGG + Intronic
919207074 1:194431599-194431621 GCTGGTTAACATTTGAACATGGG + Intergenic
924204510 1:241698049-241698071 CTTGGGTTTCATTAGTACATAGG - Intronic
924748271 1:246859361-246859383 CCAGGGGAACACTAGTAAATGGG - Intronic
1064183396 10:13139346-13139368 CCAGGGTAACATGAGAGCATCGG - Intergenic
1067034552 10:42903362-42903384 CCTTGGTAACATAACTCCATTGG + Intergenic
1071746606 10:88426829-88426851 AGGGGGTAACAGTAGTACATGGG + Intronic
1073880051 10:107970685-107970707 CATGAGTCACATTAGTAAATAGG + Intergenic
1073884027 10:108017204-108017226 CCTGAGTAAAATAAATACATAGG + Intergenic
1074344027 10:112663613-112663635 CCTGAGTAACATCAATACAGAGG + Intronic
1085468822 11:76743715-76743737 CCAAGCAAACATTAGTACATCGG - Intergenic
1086252152 11:84828896-84828918 CATTGGCAGCATTAGTACATAGG - Intronic
1086736377 11:90310889-90310911 CCTCAGTAAGATTAGAACATGGG - Intergenic
1089389803 11:118093099-118093121 CTTGGGTAACACTAGGCCATGGG - Intronic
1092679696 12:10965155-10965177 TCTGGGTAATATTATTACATTGG - Intronic
1092682279 12:10997678-10997700 TCTGGGTAATATTATTACATTGG - Exonic
1092686128 12:11049058-11049080 TCTGGGTCATATTATTACATTGG - Intronic
1092688431 12:11078045-11078067 TCTGGGTCATATTATTACATTGG - Intronic
1108238345 13:48433264-48433286 CCTGGGTAAATATAGAACATAGG + Intronic
1113813412 13:113155477-113155499 CCAGGCTGACATTAGAACATTGG + Intergenic
1121786017 14:96661614-96661636 CCTGGGTATCATTGGAATATGGG - Intergenic
1129004552 15:72361355-72361377 CCTGGGTAACATTAGTACATTGG - Intronic
1133448741 16:5885650-5885672 CCTGGGCAACATTAGCATAGCGG - Intergenic
1136134014 16:28243215-28243237 CCTGGGCAACATAGGAACATAGG - Intergenic
1138974565 16:62188116-62188138 CCTGTGTAACAGTTATACATTGG - Intergenic
1139223091 16:65204679-65204701 CCTGGGGAACATTTTTAAATAGG - Intergenic
1140840047 16:78830064-78830086 CCTGGGTAACATAGTAACATAGG + Intronic
1142769922 17:2089290-2089312 CCTGGGCTACATTAGCACGTGGG + Intronic
1156860467 18:41829979-41830001 CCTGGTCAACATTATTTCATAGG - Intergenic
1159815183 18:73065146-73065168 AATGGGAAACATTAGTACTTGGG + Intergenic
1160660637 19:296781-296803 CCTGGGTAAAATTTGTTCTTGGG - Intergenic
940775279 2:157877135-157877157 TCTGGGTAATATTAGCACACTGG - Intronic
941934568 2:170973156-170973178 TCTGGGTAACACCAGTCCATGGG - Intergenic
942869762 2:180720784-180720806 CCTTCTTAACATTTGTACATAGG - Intergenic
944137449 2:196414681-196414703 CCTGGGTAACATCAGCCCCTGGG + Intronic
946627189 2:221625824-221625846 CCTCAGTCACATTGGTACATTGG - Intergenic
946779106 2:223174518-223174540 CCTGGGTAACAATTTTAGATGGG + Intronic
1174904757 20:54538847-54538869 ACTGTGTTACATTAGTACAATGG + Intronic
1178025181 21:28458039-28458061 CCTGGGAGACAATAGTCCATGGG + Intergenic
1183126038 22:35783202-35783224 CCTGTGTAACATGGGAACATGGG - Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
955496727 3:59541309-59541331 TCTGGGTAACTTGAGTATATTGG + Intergenic
957348811 3:78996429-78996451 CATGGGTAAAATAAGTACAAAGG - Intronic
958804282 3:98790884-98790906 CCTAGGTTACAATGGTACATAGG + Intronic
962420816 3:135227093-135227115 CATGTGTAAGATTATTACATGGG - Intronic
965248390 3:166307306-166307328 CCTGGGCAACATTGCTATATTGG - Intergenic
973813787 4:54599338-54599360 ACTGGGAAACATTAGAACAGTGG + Intergenic
975739756 4:77418410-77418432 CCTTGGTAACATTGGTTTATTGG + Intronic
977429673 4:96915343-96915365 CCTGGGTAGCCTTACAACATTGG - Intergenic
979083497 4:116374565-116374587 CAAGGGGAACAATAGTACATTGG - Intergenic
979670309 4:123354394-123354416 CCTAGGTAACAGCAGTGCATAGG + Intergenic
981167872 4:141583122-141583144 CCTGTGTAACAATAATACAATGG + Intergenic
987436903 5:17905937-17905959 CCTTGGGAACATAAGTCCATTGG - Intergenic
991878685 5:71200809-71200831 CCTGGGAAACAATAATAAATAGG + Intergenic
993440392 5:87949896-87949918 TCTGGGTACCATTAGTGCACTGG + Intergenic
999519406 5:152335267-152335289 CCTGCTTCACATTAGTGCATTGG + Intergenic
1001194493 5:169659523-169659545 GCTGAGTAAATTTAGTACATAGG - Intronic
1002093922 5:176819765-176819787 CCTGGGTAACAACAGGACAATGG - Intronic
1003494892 6:6655108-6655130 CCTGGCTAAAATTAGAACACTGG + Intergenic
1015555748 6:134459674-134459696 CCTGGGTAACAATAGGCTATGGG - Intergenic
1015982544 6:138853678-138853700 CCTGGGAAACATTTCTACTTTGG + Intronic
1017544603 6:155437605-155437627 TCTGGGCATCATTTGTACATTGG - Intronic
1020891981 7:13889536-13889558 CCTGGGCAACATAAGAACATGGG + Intergenic
1022882185 7:34599559-34599581 CCTAGGACATATTAGTACATGGG - Intergenic
1024720801 7:52135937-52135959 CCTGGGTAGCCTCAGTACAGGGG + Intergenic
1031206359 7:118763089-118763111 CCTGGGTATCATTTGGATATAGG + Intergenic
1031340596 7:120595288-120595310 CCTGGCTAATTTTTGTACATTGG - Intronic
1035415719 7:158683897-158683919 TCTGAGTACCATTAGTGCATGGG - Intronic
1035469312 7:159099660-159099682 CCTGGGAGACATTAGGACAGAGG - Intronic
1041936602 8:63338812-63338834 TCTGAGTAACAATAGTACACTGG - Intergenic
1046001222 8:108422984-108423006 CCTGGGGTATATTATTACATGGG - Intronic
1052761392 9:32595828-32595850 CCTGGGTACCCTTTGTACCTTGG - Intergenic
1189368733 X:40410943-40410965 CCTACGTTACATTGGTACATTGG - Intergenic
1193645204 X:84059559-84059581 CCTGAGCAATATTAGTTCATAGG + Intronic
1197837787 X:130713600-130713622 CCAAGGTAACATTAGTTCACAGG - Intronic
1198697933 X:139363745-139363767 CCTGGGAAACATTAATATTTAGG - Intergenic