ID: 1129009658

View in Genome Browser
Species Human (GRCh38)
Location 15:72403980-72404002
Sequence CCTCATGGTAGAAGAGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 482}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129009658 Original CRISPR CCTCATGGTAGAAGAGGAAC TGG Intronic
901674183 1:10873280-10873302 CCTCAGGGGAGAATAGGAACAGG + Intergenic
901708069 1:11091597-11091619 CCTAAGAGTAGAAGAGGTACTGG + Exonic
902804850 1:18854608-18854630 CCTCATTGAAGAAGTGGTACAGG + Exonic
903517791 1:23924009-23924031 CCTCTTGGAGGAAGAGGGACAGG + Intergenic
903925045 1:26826247-26826269 CTTCAAGGTAGAAGAGGTCCTGG + Intergenic
904966047 1:34373507-34373529 CCTGATCCTAGAAGAGGAACAGG - Intergenic
906170827 1:43723440-43723462 ACTCATGGCAGAAGCGGAAAGGG - Intronic
906960152 1:50415365-50415387 CCTCCTGGGAGAAGGGGAAACGG - Intergenic
909060274 1:70871195-70871217 ACTCATGGTGGAAGATGAAGTGG + Intronic
909364897 1:74808125-74808147 ACTCATGGCAGAAGGGGAAAGGG + Intergenic
910645788 1:89513784-89513806 TCTCATGGTAGAAGGGAAAGTGG + Intergenic
911821682 1:102431462-102431484 AATCATGGTGGAAGAGGAAGTGG - Intergenic
911879878 1:103223888-103223910 ACTCATGGAAGAAGATGAAGTGG - Intergenic
912405811 1:109436667-109436689 CTTCATGGTAAAAGAGGAGCGGG + Intergenic
912479472 1:109969718-109969740 ATTCATGGTAGAAGGGGAAGTGG - Intergenic
913050287 1:115111656-115111678 TCACATGGTAGAAGGGGAAGGGG - Intergenic
913078990 1:115364481-115364503 CTTCTTGGTAGAAGAGGGAATGG - Intergenic
913345490 1:117805438-117805460 ACTCATGGAAGAAGGGGAAGGGG + Intergenic
913365106 1:118028912-118028934 TCACATGGCAGAAGAGGAAGAGG - Intronic
914094943 1:144537223-144537245 CATCAATATAGAAGAGGAACTGG + Intergenic
914303580 1:146396675-146396697 CATCAATATAGAAGAGGAACTGG - Intergenic
915044603 1:153001402-153001424 CCTCATGGTTGAAGTGGACATGG - Intergenic
915257175 1:154642743-154642765 TCTCATGGTGGAAGATGAAAGGG + Intergenic
917716878 1:177747302-177747324 CCTCATGGATCAAGAGGAAATGG + Intergenic
918403593 1:184190260-184190282 CCTCATGGTGGAAGATGGAAAGG + Intergenic
919498632 1:198309543-198309565 CCTAATGCTAGAAGACGAGCTGG - Intronic
919852138 1:201680142-201680164 ACTCATGGCAGAAGGTGAACGGG + Intronic
920509792 1:206542404-206542426 ACTCATGGTAGAAGGGGAAGGGG - Intronic
922214707 1:223510779-223510801 ACTCATAGCAGAAGAGGAAGTGG - Intergenic
923021837 1:230170710-230170732 CATCATGGTAGAAGGTGAAGGGG + Intronic
923213003 1:231822793-231822815 ACTCATGGCAGAAGATGAAGGGG + Intronic
923468584 1:234269878-234269900 ACTCATGGCAGAAGCGGAAGGGG - Intronic
924333367 1:242962990-242963012 CCTCATGCTACCAGAGGACCTGG + Intergenic
924730848 1:246710347-246710369 CCTCATGGTAGAAGGTGAAGAGG + Intergenic
924775986 1:247114709-247114731 CCTCAGGGTAGAGAAGGAGCTGG + Intergenic
1063707746 10:8447265-8447287 CCTCAGGCTGAAAGAGGAACAGG - Intergenic
1063770252 10:9189367-9189389 ACTCTTGGTGGAAGAGGAACGGG - Intergenic
1065148295 10:22795494-22795516 ACTCATGGTGGAAGATGAAGCGG - Intergenic
1065585183 10:27210813-27210835 TCTAATGTTAGAAGAGGAAGAGG - Exonic
1065789744 10:29249910-29249932 ACTCATGGTAGAAGGGAAGCAGG - Intergenic
1065972433 10:30816195-30816217 ACTCATGGCAGAAGGGGAAGGGG + Intergenic
1066066439 10:31764679-31764701 ACTCATGGCAGAAGGGGAAGGGG - Intergenic
1066462456 10:35623855-35623877 ACTCATGGCAGAAGATGAAAGGG + Intergenic
1066629495 10:37445071-37445093 ACTCATGGTAGAAGGTGAAAGGG - Intergenic
1067141676 10:43663066-43663088 CCTCATGGCAGAAGGTGAAGGGG + Intergenic
1067518401 10:46974668-46974690 ACTCATGGTAGAAGGTGAAGTGG + Intronic
1067643848 10:48077160-48077182 ACTCATGGTAGAAGGTGAAGTGG - Intergenic
1068217594 10:54002905-54002927 CCACATGGTGGAAGGGGACCTGG - Intronic
1068769819 10:60808578-60808600 ACTCCAGCTAGAAGAGGAACAGG - Intergenic
1070083948 10:73216696-73216718 CCACCTGGTAGAGGAGGGACAGG - Intronic
1071255291 10:83866762-83866784 CCTCATGGTAGGAGGGTGACAGG + Intergenic
1072018919 10:91379479-91379501 CTTGATGGCAGAAGAGAAACAGG + Intergenic
1072451516 10:95542839-95542861 CTTCATTGTAGAAGGGGAAGAGG - Intronic
1073489146 10:103841210-103841232 CCTCATGCTAGCAGAGGGTCTGG - Intronic
1073873544 10:107894670-107894692 CCTCATGGTGGGAGGTGAACGGG + Intergenic
1074014703 10:109522295-109522317 TCACATGGTAGAAGGGGAAAAGG + Intergenic
1074650772 10:115522306-115522328 ACTCATGGCAGAAGAGGAAGCGG + Intronic
1074650974 10:115524026-115524048 ATTCATGGTGGAAGAGGAAGGGG + Intronic
1075035601 10:119064569-119064591 CATCATGGTGGAAGGGGAACGGG - Intronic
1075549602 10:123382488-123382510 ATTCATGGTGGAAGAGGAAGTGG + Intergenic
1075990595 10:126835479-126835501 CCACATGGTAGAAGAGGGTGGGG + Intergenic
1076723422 10:132402618-132402640 GCTCATGGAAGATGATGAACTGG + Intronic
1077554315 11:3218618-3218640 CCACACGGCAGGAGAGGAACAGG + Exonic
1077587922 11:3468434-3468456 ACTTATGGTATAAGAGGAAATGG - Intergenic
1077759157 11:5072069-5072091 CCTCAGGGAAGAGGAGAAACAGG + Intergenic
1078443252 11:11385061-11385083 ACTCATGGTGGAAGGGGAAGGGG + Intronic
1078520281 11:12057472-12057494 CATCATGGCAGAAGGGGAAGGGG - Intergenic
1078774570 11:14382582-14382604 AATCATGGCAGAAGAGGAAGGGG + Intergenic
1079079262 11:17402622-17402644 CCCCAAGGTAGGAGTGGAACAGG - Intronic
1079160097 11:17984319-17984341 AATCATGGTGGAAGAGGAAGCGG + Intronic
1079408540 11:20165553-20165575 CCTCATGGTGGGACAAGAACTGG - Intergenic
1079687909 11:23384291-23384313 AATCATGGCAGAAGAGGAAGAGG - Intergenic
1080386064 11:31811812-31811834 CCCCTTGGAAGAAGAGGAAAGGG + Intronic
1080598002 11:33792782-33792804 CAGCATGGTAGAACAGGAAGAGG - Intergenic
1080776766 11:35393892-35393914 CCACAGGGAAGAAGAGGAAAAGG - Intronic
1080805272 11:35647632-35647654 CCTTATGGTGGAAGATGAAGGGG + Intergenic
1081043536 11:38242129-38242151 AATCATGGTGGAAGAGGAAGAGG + Intergenic
1081429756 11:42963511-42963533 CCTCATGGCAGAAAATGTACTGG - Intergenic
1081551373 11:44115768-44115790 CCACATGGTAGAACACAAACAGG - Intronic
1081793753 11:45805785-45805807 ATTCATGGTAGCAGAGGAGCTGG - Exonic
1082990229 11:59201151-59201173 CCACATGGTAGAAGGGGCAAGGG + Intronic
1084540053 11:69780816-69780838 CTTCAGAGTAGAAGAGAAACAGG - Intergenic
1084829066 11:71754501-71754523 ACTTATGGTATAAGAGGAAATGG + Intergenic
1084976404 11:72801633-72801655 CCACATGGTAGAAGAGGCCTGGG - Intergenic
1085068368 11:73518950-73518972 ACTCATGGCAGAAGGGGAAGGGG - Intronic
1085539845 11:77256792-77256814 ACTCATGGCAGAAGATGAAGGGG - Intronic
1086925449 11:92635172-92635194 CCTCATGATGATAGAGGAACAGG - Intronic
1087101114 11:94365571-94365593 ACTCATGGTAGAAGACGAAGTGG - Intergenic
1087306931 11:96499715-96499737 CCTCCTGTTAGAAGGGAAACGGG - Intronic
1087590261 11:100178121-100178143 CCTTATGGTAGAAGAGGGAGTGG - Intronic
1087739217 11:101868712-101868734 TCACATGGTAGAAGAGGCAAAGG + Intronic
1087889491 11:103520539-103520561 TCTCATTGTAGAAGAGGCAAGGG - Intergenic
1088733327 11:112703426-112703448 AATCATGGTGGAAGGGGAACAGG - Intergenic
1089154449 11:116390196-116390218 AATCATGGTAGAAGGGGAAGCGG + Intergenic
1089193859 11:116679425-116679447 ATTCATGGCAGAAGAGGAGCAGG - Intergenic
1090429411 11:126633585-126633607 GCTCATGGCAGAAGGGGAAATGG - Intronic
1090521368 11:127483056-127483078 CCTCATGGTGGAAGGTGAAGCGG + Intergenic
1090833509 11:130437042-130437064 CCACATGGTGGGAGAGGAAGGGG + Intergenic
1090952996 11:131489995-131490017 ACTCATGGTAGAAGATGAAAGGG + Intronic
1091348075 11:134868701-134868723 CTTCCTGGGAGAGGAGGAACGGG + Intergenic
1091628191 12:2138690-2138712 ACTCATGGCAGAAGGGGAAGGGG - Intronic
1091985263 12:4905940-4905962 CCTGAGGGTAGAAAAGGAAGAGG - Intergenic
1092414169 12:8277186-8277208 ACTTATGGTATAAGAGGAAATGG - Intergenic
1093083482 12:14840643-14840665 CCTCCTGAAAGAAGAGGCACAGG - Exonic
1093411713 12:18876132-18876154 ACTCATGGTAGAAGGGGAGGGGG + Intergenic
1094354501 12:29563827-29563849 CCCTGTGGTAGAAGAGAAACAGG + Intronic
1095304715 12:40625990-40626012 ACTCATGGTGGAAGGGGAAGGGG + Intergenic
1095712763 12:45307972-45307994 CAGAATGGAAGAAGAGGAACTGG + Intronic
1099167236 12:79321595-79321617 CCTGAAGGTAGAAAAGGAATGGG + Intronic
1099193343 12:79583738-79583760 ACTCACAGTAGAAGAGGAAGGGG - Intronic
1099237182 12:80095610-80095632 TCTCATGGTAGGTGAGGACCAGG + Intergenic
1100124388 12:91406126-91406148 ACTCATGGCAGAAGGTGAACAGG + Intergenic
1100380715 12:94059233-94059255 ACTCATGGTGGAAGTGGAAGGGG - Intergenic
1100466549 12:94850606-94850628 ACTCATGGCAGAAGGAGAACGGG + Intergenic
1100638867 12:96461913-96461935 ACTCATGGTAGAAGGTGAAGGGG + Intergenic
1101071449 12:101080315-101080337 GTTCATGGGAGAAGGGGAACAGG - Intronic
1101840236 12:108322705-108322727 ATTCATGGTAGAAGGGGAAGGGG - Intronic
1102467634 12:113139200-113139222 CCTCATCCCAGAAGAGGAATCGG + Intergenic
1102626278 12:114237770-114237792 TCTCATGCCAGACGAGGAACTGG - Intergenic
1103449564 12:121018911-121018933 TCACATGGTAGAAGAGGCAAAGG - Intergenic
1104549355 12:129742325-129742347 CCTCATGGTGGAAGGTGAAGAGG + Intronic
1105620792 13:22064035-22064057 CATCATGGGAGAAGTGGCACTGG - Intergenic
1105754152 13:23449448-23449470 CTTCCTGGGAGAAGAGGAAAGGG - Intergenic
1105936644 13:25106664-25106686 CGTGATGGTAGAAAAAGAACAGG + Intergenic
1106189096 13:27434956-27434978 CCTCATGGAAGGAGAGGATATGG - Exonic
1106353806 13:28959585-28959607 ACTCATGGCAGAAGATGAAGGGG + Intronic
1106522641 13:30511446-30511468 ACTCATGGAAGAAGATGAAGGGG - Intronic
1106699206 13:32211029-32211051 CCTCAGGTAAGAAGAGCAACCGG + Exonic
1106948980 13:34861579-34861601 ACTCATGGTAGAAGGTGAAGAGG - Intergenic
1107034192 13:35883443-35883465 ACTCATGGTGGAAGGGGAAGGGG - Intronic
1107777723 13:43864471-43864493 ACTCATGGTAGAAGGTGAAGAGG + Intronic
1108445063 13:50500400-50500422 ACTCATGGAAGAAGATGAAGTGG + Intronic
1108680249 13:52773907-52773929 AGTCATGGTAGAAGGGGAAACGG + Intergenic
1109642488 13:65208873-65208895 ACTCATGGTAGAAGGTGAAGGGG - Intergenic
1110849519 13:80229161-80229183 ACTCATGGTAGAAGGTGAAAGGG + Intergenic
1110955603 13:81549205-81549227 AATCATGGCAGAAGAGGAAAAGG + Intergenic
1111583905 13:90260458-90260480 AATCATGGTAGAAGGGGAAGGGG + Intergenic
1112179359 13:97062334-97062356 ACTCATGGTGGAAAAGGAAGGGG + Intergenic
1112786877 13:102961115-102961137 ACTCATGGTAGAAGGGAAAGGGG + Intergenic
1113773887 13:112931223-112931245 CCTCACGGAAGAAGAGGAACAGG + Intronic
1114351005 14:21851110-21851132 TCTCATAGTTGAAGAGGAATAGG - Intergenic
1116503190 14:45646004-45646026 TCACATGGTAGAAGAGCAAGGGG - Intergenic
1116631404 14:47339643-47339665 ACTCATGGTGAAAGAGGAAGGGG - Intronic
1120323937 14:83001881-83001903 CATTATGATAGAGGAGGAACAGG - Intergenic
1120506024 14:85354012-85354034 AGTCATGGTAGAAGATGAAGGGG - Intergenic
1120701558 14:87704545-87704567 CCTCATGGAAGAGGATAAACTGG - Intergenic
1120842429 14:89097522-89097544 CCTTAGGGTGGAAGAGGAATGGG - Intergenic
1120968873 14:90191224-90191246 GCTCATGGTAGAGGAGGAAGGGG + Intergenic
1121307073 14:92913175-92913197 CTACATGAGAGAAGAGGAACGGG + Intergenic
1122432349 14:101661899-101661921 ACTCATGGCAGAAGGGAAACAGG - Intergenic
1123191378 14:106575547-106575569 CCTCATGGGACAAGAGAATCTGG - Intergenic
1124601424 15:31135804-31135826 ACTCATGGTGGAAGAGGAAGAGG - Intronic
1125678826 15:41517851-41517873 CCTCATCCTAGAAGCAGAACAGG + Exonic
1126127919 15:45313148-45313170 ACTCATGGTAGAAGGTGAAAGGG - Intergenic
1126233999 15:46361184-46361206 CCTTATGGTAGAATTGGAAATGG - Intergenic
1126321523 15:47429285-47429307 CCTCATTGTATAAGAGGACTCGG - Intronic
1127137456 15:55939376-55939398 AGTCATGGCAGAAGATGAACAGG - Intronic
1127201363 15:56655972-56655994 TCTACTGGTAGAAGAGGCACGGG - Intronic
1127528689 15:59820120-59820142 CTGCATGGAAAAAGAGGAACAGG + Intergenic
1127708152 15:61567616-61567638 CCTTATGGAAGAAGATGAAGGGG + Intergenic
1128612397 15:69084525-69084547 CCTCAGGGAAGAGGAAGAACAGG + Intergenic
1129009658 15:72403980-72404002 CCTCATGGTAGAAGAGGAACTGG + Intronic
1129741196 15:77990414-77990436 CCTCAGGGGAGAAGAGGGAGTGG + Intronic
1129907296 15:79197422-79197444 CCTCATGGAAGAGGAGCAGCAGG + Intergenic
1130038022 15:80379183-80379205 ACTCATGGTGGAAGAGGAAGGGG - Exonic
1130203045 15:81851093-81851115 CCTCAAGCTGGAAGAGGAAAAGG + Intergenic
1130274612 15:82469903-82469925 CCACATGGTAGAGCAGGAGCTGG - Intergenic
1130466958 15:84197277-84197299 CCACATGGTAGAGCAGGAGCTGG - Intergenic
1130497306 15:84476259-84476281 CCACATGGTAGAGCAGGAGCTGG + Intergenic
1130589255 15:85201870-85201892 CCACATGGTAGAGCAGGAGCTGG - Intergenic
1130776738 15:86992105-86992127 ACTCATGGCAGAAGGGGAAGTGG + Intronic
1133249865 16:4474114-4474136 CCTCATGGTGGACAAGAAACTGG - Exonic
1133298175 16:4765798-4765820 CCTCCTGGTAGCAGAAGAGCCGG + Exonic
1133355356 16:5132407-5132429 ACTTATGGTATAAGAGGAAATGG - Intergenic
1133761817 16:8804916-8804938 CCTCTAGGAAGATGAGGAACGGG + Intronic
1133837656 16:9381032-9381054 ACTCATGGTGGAAGGGGAAGGGG + Intergenic
1134151088 16:11805402-11805424 CCTCATGGTGGAAAAGGATGAGG - Intergenic
1134771995 16:16817093-16817115 CTTCACGGGAGAAGAGAAACTGG - Intergenic
1135153664 16:20032903-20032925 CCTCATCTTAGAAGTGAAACTGG + Intronic
1135678538 16:24437806-24437828 ACTCATGGTGGAAGGGGAAGAGG - Intergenic
1135873148 16:26170657-26170679 ACTCATGGTGGAAGAGAAAGTGG - Intergenic
1136393797 16:29982021-29982043 GCTCTTGGTGGAGGAGGAACTGG - Intronic
1137791157 16:51175954-51175976 ACTCATGGCAGAAGGGGAAGGGG - Intergenic
1137885268 16:52096072-52096094 AATCATGGTAGAGGAGGAAGAGG - Intergenic
1138266466 16:55663400-55663422 ACTCATGGCAGAAAAGGAAAGGG - Intronic
1138863990 16:60794422-60794444 ACTTATGGGAGAAGGGGAACTGG - Intergenic
1139032025 16:62895681-62895703 ACTCATGGCAGAAGGGGAAAGGG - Intergenic
1139055108 16:63173909-63173931 ACTCATGGTGAAAGGGGAACGGG - Intergenic
1139159094 16:64481526-64481548 CCTCATGGGAAAAGAGAACCAGG + Intergenic
1139335430 16:66227714-66227736 AATCATGGTAGAATGGGAACGGG + Intergenic
1140687984 16:77451935-77451957 ACTCATGGTGGAAGGGGAAGGGG - Intergenic
1141291684 16:82723548-82723570 CCACCTGGAAGAAGAGGATCTGG + Intronic
1141352676 16:83312665-83312687 GCTGATGTTAGAAGAGGGACAGG + Intronic
1141470722 16:84236729-84236751 CCTCAGGGCAGAGGAGGACCAGG - Exonic
1144201465 17:12946102-12946124 TTTCATGGAAGAAGATGAACTGG + Intronic
1144280001 17:13716771-13716793 CTTGATGGTAGAAGAGACACAGG - Intergenic
1144442048 17:15292391-15292413 ACTCATGGCAGAAGAGGAAGGGG - Intergenic
1146931003 17:36778073-36778095 CATCATAGTAGATGAGGAAATGG + Intergenic
1148776479 17:50098542-50098564 CCTCATTGTGGAAGTGTAACAGG + Intronic
1151112890 17:71700447-71700469 CCTACTGGTAGAAGAGGAAAAGG + Intergenic
1151971474 17:77459649-77459671 CCTCATGGTAGAAGGTGAAGGGG + Intronic
1152097508 17:78280452-78280474 CCTCATGGGAGAAGAGGTGGTGG + Intergenic
1152758581 17:82097324-82097346 CCTCATGCTGGAGGAGGAGCCGG - Intronic
1154221160 18:12455354-12455376 CCTAATGGTACGAGTGGAACTGG + Intronic
1155358094 18:24973133-24973155 ACACATGGTAGAACAGGGACAGG - Intergenic
1155451555 18:25969005-25969027 CCTCAGGGTTGAAGAGGAATAGG + Intergenic
1155996324 18:32334572-32334594 CCACATGGAAGCGGAGGAACAGG + Intronic
1156475319 18:37402295-37402317 CCACATGGGAGAAGAGGCATTGG + Intronic
1157488188 18:48104345-48104367 ACTCATGGTGGAAGAGGAAGGGG - Intronic
1157768103 18:50318082-50318104 ACTCATGGTGGAAGAGGAAGGGG - Intergenic
1157999042 18:52594704-52594726 ACTCATGGCAGAAGATGAAGTGG + Intronic
1158236538 18:55322175-55322197 CCTTAGGGTAAAAGTGGAACAGG + Intronic
1159510664 18:69394948-69394970 CCTCATGGTACAAGTGAAAACGG + Intergenic
1159618878 18:70614266-70614288 CATCATGGTGGAAGACGAAGGGG - Intergenic
1160041251 18:75347701-75347723 CCTCATGGCAGAAGGCGAAGGGG + Intergenic
1160242562 18:77133564-77133586 CCTGATGGTGGAAGAGGAGGAGG + Intronic
1161762660 19:6185743-6185765 CCTCTTGGAAGGTGAGGAACTGG - Intronic
1162509936 19:11111871-11111893 CCTACTGGTGGAACAGGAACCGG + Intronic
1162771731 19:12953405-12953427 CCTCATCCTAGAAGAGGATGGGG - Exonic
1162863694 19:13527457-13527479 CATCATGGTAGAAGGTGAAAGGG + Intronic
1164309842 19:24035942-24035964 ACTCATGGTGGAAGATGAAGTGG - Intronic
1165001916 19:32771090-32771112 AATCATGGCAGAAGGGGAACAGG + Intronic
1166328017 19:42062966-42062988 CCGGATGGCAGAAGAGGATCAGG - Intronic
1166420759 19:42634126-42634148 CCTCAGTGTAGAGGAAGAACAGG + Intronic
1166496331 19:43305628-43305650 CCTCTGTGTAGAAGAAGAACAGG + Intergenic
1166503474 19:43357160-43357182 CTTATTGGTAGAAGAGGAAGAGG + Intronic
1166506980 19:43377601-43377623 CTTATTGGTAGAAGAGGAAGAGG - Intergenic
1167747069 19:51358136-51358158 CCACATGGGAGAAGAGGAAGAGG - Intronic
925400152 2:3566863-3566885 ACTCATGGCAGAAGGGGAAGGGG - Intergenic
925747721 2:7057913-7057935 CTTCCTGGAGGAAGAGGAACTGG + Intronic
925831011 2:7895538-7895560 GCAGAAGGTAGAAGAGGAACTGG - Intergenic
926203409 2:10817648-10817670 CCGCCTGGTGGAAGAGGAACAGG - Intronic
926849996 2:17185950-17185972 CCTCAAGGAAGCAGAAGAACTGG + Intergenic
927346814 2:22053789-22053811 AATCATGGTAGAAGGGGAATAGG + Intergenic
927999135 2:27507686-27507708 CCTCCTGGGAGAAGGTGAACTGG - Exonic
928002001 2:27531540-27531562 ACTCATGGCAGAAGGGGAAAGGG - Intergenic
928086600 2:28350053-28350075 CCTCATGGAGGAAGAGGAGGAGG - Intergenic
928571622 2:32615049-32615071 ACTCATGGTGGAAGATGAAGCGG + Intronic
928797155 2:35035479-35035501 AATCATGGTGGAAGAGGAAGAGG + Intergenic
930639362 2:53839610-53839632 CATCATGGCAGAAGGGGAAGGGG - Intergenic
931335735 2:61341580-61341602 TCTCATGGCAGAAGTGGAAACGG - Intronic
931528024 2:63179521-63179543 CCTCATGGCAGAAGGTGAAATGG - Intronic
933282391 2:80346318-80346340 ACTCATGGTAGAAGGTGAAGTGG + Intronic
934083923 2:88493604-88493626 GGTCATGGGAGAAGAGGAGCAGG - Intergenic
934538050 2:95152769-95152791 CCTGATGGTAGAGAAGGAAAAGG + Exonic
935870773 2:107446676-107446698 ACTCATAGTGGAAGAGGAAGGGG + Intergenic
937068982 2:119047675-119047697 CCTCAAGGAACTAGAGGAACAGG - Intergenic
937550729 2:123086795-123086817 ACTCATGGCAGAAGGGGAAGTGG - Intergenic
939696183 2:145327856-145327878 CCTCATGGTGGAAGGGGAAGGGG + Intergenic
940043142 2:149381118-149381140 CAAAATGGAAGAAGAGGAACTGG + Intronic
940284755 2:152023050-152023072 AATCATGGTAGAAGGGGAAGAGG + Intronic
940577078 2:155522585-155522607 CCACATGGTAGCGTAGGAACCGG + Intergenic
940599436 2:155839227-155839249 TCTCATCTTAGAAGAAGAACTGG - Intergenic
941728425 2:168889501-168889523 CATAATGGTAGAGGACGAACTGG - Exonic
941815072 2:169788170-169788192 CCTCCTGGTAGAGAAGGAGCTGG - Intergenic
942180018 2:173371229-173371251 ACTCCTGGTTGCAGAGGAACTGG + Intergenic
942430657 2:175907597-175907619 TCACATGGTTGAAGAGGAAGGGG + Intergenic
942518950 2:176782839-176782861 ACTCATGGTGGAAGAGGAAGAGG - Intergenic
943894175 2:193331772-193331794 CATCATGAGAGAAGAGGAAATGG + Intergenic
944007381 2:194926473-194926495 CCTCCTGGAAGAGGAGGATCTGG + Intergenic
944016929 2:195051775-195051797 CCTCATGGTAGAAGGTGAAGGGG - Intergenic
944917788 2:204378528-204378550 ACTCATGGCAGAAGATGAAGGGG - Intergenic
945778421 2:214136005-214136027 ACTCATGGCAGAAGAGGAAGGGG + Intronic
946252100 2:218419950-218419972 GCTCATGATAGAAGAGGGAATGG - Intronic
947274976 2:228380372-228380394 AATCATGGTAGAAGATGAAGAGG - Intergenic
1169399036 20:5264194-5264216 CCTCATGGTGGAAGGTGAAGGGG + Intergenic
1171557977 20:26095604-26095626 CCTCTAGGCAGAAGAGTAACAGG - Intergenic
1172176829 20:32977569-32977591 CCTCATGGAAGGTGAGGACCCGG - Intergenic
1174174388 20:48635840-48635862 CCCCATGTGAGAAGAGGAAGGGG + Intronic
1174553889 20:51380511-51380533 GCTCATGGTGGAAGAGGCAGGGG + Intergenic
1177212161 21:18084212-18084234 AATCATGGTAGAAGATGAAAGGG - Intronic
1177624531 21:23643608-23643630 AATCATGGCAGAAGAGGAAGGGG + Intergenic
1178293934 21:31392852-31392874 ACTCATGGCAGAAGATGAAGGGG - Intronic
1178387380 21:32163945-32163967 ACTCATGGTGGAAGGTGAACAGG + Intergenic
1178457200 21:32766487-32766509 CCTCTTTGTAGAAGAGGAGAGGG - Intronic
1179407635 21:41138608-41138630 ACTCATGGTAGAAGGTGAAGTGG - Intergenic
1179464651 21:41563413-41563435 CCAGATGGTGGAGGAGGAACTGG + Intergenic
1180599504 22:17007064-17007086 CCTCAGGGAAGCAGAGGAAAGGG + Intronic
1180625976 22:17193785-17193807 CCTTATGATATAAAAGGAACAGG + Intronic
1180919416 22:19512925-19512947 ACTCATGGCAGAAGGGGAGCTGG + Intronic
1181360132 22:22327855-22327877 CCTCCTGGTAGAGGAGGAAGGGG - Intergenic
1181370358 22:22410321-22410343 CCTCCTGGCAGAGGAGGAAGTGG - Intergenic
1181372974 22:22432504-22432526 CCTCCTGGCAGAAAAGGAAGGGG - Intergenic
1181393156 22:22598728-22598750 ACTCATGGCAGAAGATGAAGGGG + Intergenic
1182110095 22:27717131-27717153 GCTCATGGCAGAAGATGAAGGGG + Intergenic
1182456717 22:30456465-30456487 ACTCATAGCAGAAGAGGAAGGGG + Intronic
949158829 3:857133-857155 CCTCATCATAGCAGTGGAACAGG + Intergenic
949371109 3:3335579-3335601 CCTCGTGGTAGAAGATGAAGTGG - Intergenic
949460206 3:4283884-4283906 TCACATGGTAGAAGAGGTATGGG + Intronic
950307494 3:11927781-11927803 ACTCATGGCAGAAGGGGAAGGGG + Intergenic
951033449 3:17907418-17907440 ACTCATGGTAGAAGGGGAAGTGG + Intronic
952253302 3:31674695-31674717 ACTCGTGGTGGAAGAGGAAGGGG - Intronic
953065985 3:39471642-39471664 CCTCATGCCAGAGGAGGAGCTGG - Intronic
953686290 3:45080928-45080950 CCTCATGGCAGAAGACAAAGGGG - Intergenic
954815079 3:53273847-53273869 ACTCATGGCAGAAGGGGAAGGGG + Intergenic
955141996 3:56278727-56278749 ACTCCTGGTGGAAGAGGAAGGGG + Intronic
955551309 3:60088050-60088072 ACTCATGGTGGAAGATGAAAGGG + Intronic
955892375 3:63663699-63663721 ACTCATGGTAGAAGGTGAAGGGG - Intronic
956914459 3:73856521-73856543 AGTCATTTTAGAAGAGGAACTGG + Intergenic
957016552 3:75070393-75070415 CCTCATGGTGGAAGGTGAAAGGG - Intergenic
957059200 3:75468062-75468084 ACTTATGGTATAAGAGGAAATGG - Intergenic
957172892 3:76761824-76761846 TCACATGGTAGAAGAGGAAATGG - Intronic
957278928 3:78125152-78125174 CCTCATGGTACAAAAAGCACTGG - Intergenic
958011850 3:87889149-87889171 ACTCATGGTAGAAGGTGAAAGGG - Intergenic
958736606 3:98016412-98016434 ACTCATGGTGGAAGGTGAACGGG - Intronic
959274485 3:104260782-104260804 CCTCATGGTAGAAGGCAAAGGGG - Intergenic
959989176 3:112611851-112611873 CCTGATGCTAGAAGGGGCACAGG - Intronic
961294253 3:125871662-125871684 ACTTATGGTATAAGAGGAAATGG + Intergenic
961436106 3:126917798-126917820 CAACATGGTAGAAAAGGAAAGGG - Intronic
961766940 3:129218839-129218861 GCTCAGGGTAGAAAAGAAACTGG - Intergenic
961891712 3:130135806-130135828 ACTTATGGTATAAGAGGAAATGG - Intergenic
962649403 3:137473490-137473512 CCTCAGGGTAGCAGAGGACAAGG - Intergenic
962775840 3:138658979-138659001 CCAAATGGGAGAAGAGGAAAGGG - Intronic
963080194 3:141384651-141384673 CCCCATGGTAAAGGAGGAATTGG + Intronic
963553865 3:146760722-146760744 ACTCATGATGGAAGAGGAAGGGG + Intergenic
964327763 3:155565519-155565541 ACTCATGGTAGAAGGTGAAGTGG - Intronic
964433922 3:156632819-156632841 GCTCTTGGTAGAAGGGGAAGAGG - Intergenic
964852687 3:161111977-161111999 AATCATGGTGGAAGAGGAACGGG - Intronic
965957249 3:174386199-174386221 CCATATGGTAGAAGAGGTAAGGG + Intergenic
966566888 3:181392951-181392973 ACTCATGGTAGAAGGTGAAGGGG + Intergenic
966656935 3:182369558-182369580 ACTGAGGGTAGAAGAGGAAACGG + Intergenic
966713359 3:182991459-182991481 CCTCATGGCAGAAGGCAAACTGG + Intergenic
967203550 3:187097944-187097966 CCTCAGGGAACAAGAGAAACAGG + Intergenic
967883787 3:194319721-194319743 ACTCATGGTGGAAGAAGAAAGGG + Intergenic
969003105 4:3998245-3998267 ACTTATGGTATAAGAGGAAATGG - Intergenic
969411273 4:7029948-7029970 CTTCCTGGTGGAGGAGGAACAGG + Intronic
969750918 4:9110282-9110304 ACTTATGGTATAAGAGGAAATGG + Intergenic
969810824 4:9646571-9646593 ACTTATGGTATAAGAGGAAATGG + Intergenic
970190193 4:13508722-13508744 ACTCATGGCAGAAGGGGAACAGG - Intergenic
970382266 4:15519819-15519841 CCTCATGTCATGAGAGGAACTGG - Intronic
970403737 4:15742424-15742446 ACTCATGGTGGAAGTGGAAGGGG - Intergenic
970577248 4:17439373-17439395 ACTCATGGTAGAAGGAGAAGGGG + Intergenic
971981840 4:33761741-33761763 ACTCATGCTAGGACAGGAACAGG + Intergenic
973598775 4:52520375-52520397 CCTGATGTTAATAGAGGAACTGG - Intergenic
973826786 4:54715490-54715512 ACTCATGGTGGAAGCGGAAGGGG + Intronic
974477187 4:62398443-62398465 ACTTATGGTAGAAGGGGAAGAGG + Intergenic
975615490 4:76242369-76242391 AGTCATGGTAGAAGATGAAAGGG - Intronic
975706322 4:77115519-77115541 AGTCATGGTAGAAGATGAAGAGG + Intergenic
975842889 4:78494430-78494452 ACTCAAGGCAGAAGAGGAAGGGG + Intronic
976994049 4:91407649-91407671 ACTCATGGTAGAAGGGAAACAGG + Intronic
979715873 4:123837007-123837029 CCCCAAGGTAGAAAAGCAACAGG - Intergenic
979790036 4:124768207-124768229 GCTCATGGCAGAAGGGGAAGGGG + Intergenic
979949016 4:126868136-126868158 AATCATGGCAGAAGATGAACGGG + Intergenic
980114174 4:128663475-128663497 CATCTAGGTAGAAGAGGAAATGG + Intergenic
980212944 4:129813738-129813760 CCTCATGGTGGAAGGTGAAGGGG + Intergenic
980219530 4:129898033-129898055 ACTCATGGCAGAAGATGAACAGG + Intergenic
980269171 4:130562295-130562317 ACTCATGGCAGAAGGGGAACGGG - Intergenic
980707473 4:136519114-136519136 AATCATGGTAGAAGACGAAGGGG + Intergenic
981038677 4:140198890-140198912 CCTAATAGTAGATGAGGCACTGG + Intergenic
981268894 4:142820423-142820445 ACTCATGGCAGAAGAGGAAGGGG - Intronic
981419398 4:144532204-144532226 ACTCATGGCAGAAGAGGAAAGGG - Intergenic
981658578 4:147140445-147140467 ACTCATGGTAGAAAGTGAACAGG + Intergenic
982770283 4:159390754-159390776 CCACATTGTGGAAGAGGACCCGG - Intergenic
983439916 4:167768683-167768705 ACTCATGGTAGAAGGCAAACGGG - Intergenic
984026127 4:174546077-174546099 AATCATGGCAGAAGAGGAAGAGG + Intergenic
984147725 4:176084275-176084297 ACTCATGGTAGAAGGTGAAGGGG + Intronic
985221602 4:187711819-187711841 CCTCAGGGGAGCAGTGGAACTGG + Intergenic
985295953 4:188437721-188437743 GGTCATGTTAGAAGAGGAAAAGG - Intergenic
986290143 5:6393187-6393209 ACTCATGGTAGAAGGTGAAGGGG - Intergenic
987047858 5:14124311-14124333 CCACATGGAAGAAGAGACACTGG + Intergenic
987144422 5:14978524-14978546 CATCATGGTGGAAGATGAAAGGG + Intergenic
987800642 5:22692193-22692215 GTTCATGGTGGAAGAGGAAGGGG - Intronic
988494950 5:31736946-31736968 CCTCATGGTGGAAGGCGAAGTGG - Intronic
989782819 5:45289901-45289923 TCTCATGGTAGAAAAGAAGCTGG + Intronic
990618847 5:57538376-57538398 CCTGATGGTTGGAGATGAACTGG - Intergenic
990714607 5:58622883-58622905 CCACATGGTAGAAGAGATCCAGG + Intronic
991102236 5:62805381-62805403 ACTCATGGTGGAAGGTGAACAGG - Intergenic
992953490 5:81883939-81883961 GCTCATGTCAGAAGAGGAAAGGG + Intergenic
993084909 5:83351180-83351202 CCTCACGGTAGAAGGTGAAAGGG - Intronic
993346816 5:86794385-86794407 ACTCATGGTGGAAGATGAAGGGG - Intergenic
994117518 5:96077724-96077746 ACTCATGGTAGAAGGAGAAGGGG - Intergenic
995152136 5:108860847-108860869 AATCATGGTGGAAGAGGAAGAGG + Intronic
995535397 5:113130751-113130773 ACTCATGGCAGAAGGGGAAGGGG - Intronic
995668052 5:114567009-114567031 ACTCATGGCAGAAGAAGAAGGGG + Intergenic
995832554 5:116370023-116370045 TCTCAGGGTAGGAGTGGAACTGG - Intronic
995918522 5:117280579-117280601 AATCATGGTAGAAAAGGAAGAGG + Intergenic
996126493 5:119731136-119731158 GCTCAGGGTAAAAGAGGAAAAGG + Intergenic
997124273 5:131210087-131210109 CCTCATGAAAGAAGATGAAGAGG - Intergenic
997196650 5:131984905-131984927 CCTCATGGCAGATGAGAAACTGG + Intronic
997359296 5:133284417-133284439 CCTCAGGGCAGAAGTGGGACTGG + Intronic
997449946 5:133974517-133974539 CCGCATGATAGAACAGGAACTGG + Intronic
997720934 5:136077944-136077966 CTTCATGGTAGAGAAGGAAGAGG + Intergenic
997779763 5:136644773-136644795 GCTCATGGTGGAAGATGAAGGGG - Intergenic
999048854 5:148499924-148499946 ACTCATGGCAGAAGATGAAGGGG - Intronic
999586664 5:153096533-153096555 CCTAATGGTAGTTGAGGACCTGG - Intergenic
999629022 5:153550688-153550710 CCTCATTTTAGCTGAGGAACAGG - Intronic
999722947 5:154412345-154412367 CTTCATGGTTGAAGGGGAAGAGG + Intronic
999805807 5:155080225-155080247 TCCCATGGCAGAAGAGGCACGGG + Intergenic
1000292596 5:159884470-159884492 TCTCATGGTGGAAGTGGAAAGGG - Intergenic
1000546419 5:162609327-162609349 AATCATGGTGGAAGAGGAAGTGG - Intergenic
1000610531 5:163368661-163368683 ACTCATGGTAGAAGGTGAAAGGG - Intergenic
1001142597 5:169157334-169157356 CCTCAGGGTAGAAGGGGCAGGGG - Intronic
1003667003 6:8120833-8120855 AATCATGGTAGAAGGGGAAGGGG + Intergenic
1003682710 6:8271774-8271796 ACTCATGGCAGAAGGGGAAGGGG + Intergenic
1004351489 6:14893888-14893910 ACTCATGGCAGAAGACAAACGGG + Intergenic
1004952979 6:20694952-20694974 ACTCATGGTGGAAGGGGAAGGGG - Intronic
1005919024 6:30382273-30382295 TCACATGGCAAAAGAGGAACAGG + Intergenic
1006244722 6:32721308-32721330 CCTGATTGTAGAAGAGGAGGTGG + Intergenic
1007245348 6:40457900-40457922 CCTCATGGCAGGACAGGAAAGGG - Intronic
1008364056 6:50655127-50655149 AATCATGGTAGAAGAGGAAGGGG - Intergenic
1008533349 6:52485728-52485750 CTTCATGGTGGAAGGGGAAGGGG - Intronic
1008584292 6:52934929-52934951 GATCATGGTAGAAGACGAAGGGG - Intergenic
1009344870 6:62600947-62600969 CCTCATGGCAGAAGGTGAAGGGG - Intergenic
1010010863 6:71046548-71046570 CCTGGTGGTGGAAGAAGAACTGG + Intergenic
1010250064 6:73697837-73697859 CTTCATGGGAGAAGGGGAAGAGG + Intronic
1010919357 6:81662882-81662904 AGTCATGGTAGAAGCGGAAACGG + Intronic
1012564000 6:100622430-100622452 CATCATGGTGGAAGGGGAAGGGG - Intronic
1014021379 6:116594041-116594063 ACTCATGGTAGAAGGGGAAGAGG + Exonic
1014694388 6:124600787-124600809 CCTTAGGGTAGAAGAGTAAAAGG + Intronic
1014928680 6:127306596-127306618 ACTCATGGCAGAAGATGAAGGGG - Intronic
1015050844 6:128837649-128837671 AATCATGGTAGAAGGCGAACGGG - Intergenic
1016479230 6:144464190-144464212 ACACGTGGTAGAAGAGGAGCTGG + Intronic
1016674866 6:146752194-146752216 AATCATGGCAGAAGAGGAATGGG + Intronic
1016675064 6:146755535-146755557 AATCATGGTAGATGAGGAAGGGG - Intronic
1017184013 6:151582699-151582721 ACTCATGGCAGAAGATGAAGGGG + Intronic
1017821530 6:158052526-158052548 AGTCATGGTGGAAGAGGAAGGGG + Intronic
1019885806 7:3903961-3903983 ACTCATGGTGGAAGGGGAAGGGG - Intronic
1020322051 7:6946356-6946378 ACTTATGGTATAAGAGGAAATGG - Intergenic
1020601470 7:10279670-10279692 AATCATGGTAGAAGATGAAGGGG + Intergenic
1020827111 7:13042906-13042928 CCTCATGGTTGCAGAGATACAGG + Intergenic
1021669495 7:23021084-23021106 CCACATGGTGGTAGAGGAAATGG - Intergenic
1024250713 7:47503872-47503894 GCTCATGGCAGAAGAGGTAAGGG + Intronic
1024466852 7:49720462-49720484 ACTCATGGTAGAAGGTGAAGGGG + Intergenic
1024888344 7:54170815-54170837 CATCAAGGTTGAAGAGGAAGTGG - Intergenic
1025708447 7:63887633-63887655 AATCATGGTAGAAGGGGAAAAGG - Intergenic
1026352546 7:69530288-69530310 ATTCATGGCAGGAGAGGAACAGG - Intergenic
1026504536 7:70970928-70970950 ACTCATGGTAGAAGGTGAAGTGG - Intergenic
1026554457 7:71394175-71394197 ACTCATGGTAGAAGAGGAAGGGG + Intronic
1027525541 7:79264787-79264809 CTTCATGGTGGAAGATGAAGGGG + Intronic
1027932086 7:84550521-84550543 CCTCATGGTAGAAGGTGAAGGGG - Intergenic
1030017599 7:105240193-105240215 CCTCATGGTGGAAGATGCAAGGG + Intronic
1030267740 7:107637743-107637765 AATCATGGTAGAAGAGAAGCAGG + Intergenic
1031165381 7:118221746-118221768 CCTAAGGGTAGAATAGGAACTGG + Intronic
1031211779 7:118838207-118838229 CTTCATGGCAGAAGGGGAAATGG + Intergenic
1031358971 7:120823614-120823636 CCTTATGGAAGATGAAGAACTGG - Intronic
1032696185 7:134338545-134338567 CCACATGGCAGAAGAGGCATAGG + Intergenic
1034878455 7:154745670-154745692 ACTCATGGCAGAAGATGAAGTGG + Intronic
1036374124 8:8185679-8185701 ACTTATGGTATAAGAGGAAATGG + Intergenic
1036876779 8:12479960-12479982 ACTTATGGTATAAGAGGAAATGG - Intergenic
1038750633 8:30292169-30292191 GCTCATGGTAGAAGGGGAAGGGG + Intergenic
1038924083 8:32118408-32118430 ACTCATGGTAGAAGGTGAAGGGG - Intronic
1038973580 8:32666334-32666356 CCTCCTTGTAGAAGAAGAAATGG + Intronic
1039035166 8:33351569-33351591 ACTCTTGGTGGAAGAGGAAGTGG - Intergenic
1039117829 8:34112319-34112341 CCTCATGGGAGAAGTGAAAGTGG + Intergenic
1039377061 8:37045161-37045183 ACTCATGGCAGAAGGGGAAGGGG + Intergenic
1039428984 8:37511014-37511036 AATCATGGTAGAAGGGGAAGCGG + Intergenic
1039765363 8:40622693-40622715 ACTCATGGCGGAAGAGGAAGGGG + Intronic
1040525655 8:48222249-48222271 ACTCATGGTGGAAGGGGAAGGGG + Intergenic
1040580471 8:48694912-48694934 CACCAGTGTAGAAGAGGAACTGG + Intergenic
1041223342 8:55673612-55673634 ACTCATGGCAGAAGGGGAAGTGG + Intergenic
1041692361 8:60701257-60701279 CATCATGGTAGAAGAGATCCCGG + Intronic
1042309978 8:67370138-67370160 CTTCATGATAGAAGAGGCAGTGG - Intergenic
1042405197 8:68396805-68396827 CCTCATGGCAGAAGGTGAAGGGG - Intronic
1043170508 8:76960086-76960108 CCTCAAGGAGGAAGAGCAACTGG - Intergenic
1043915899 8:85921750-85921772 ACTCATGGCAGAAGGTGAACGGG - Intergenic
1044452061 8:92348099-92348121 GCTCAAGGTAAAAGAGAAACTGG - Intergenic
1045168957 8:99642333-99642355 CAGCCTGGTCGAAGAGGAACTGG + Exonic
1045436869 8:102172706-102172728 ACTCATGGTAGAAGCAGAAGCGG + Intergenic
1045594847 8:103641803-103641825 ACTCATGGTGGAAGATGAAGGGG - Intronic
1045929120 8:107602792-107602814 CCTCAAAGTCAAAGAGGAACTGG + Intergenic
1046068934 8:109226975-109226997 ACTCATGGCAGAAGATGAAGGGG - Intergenic
1046177191 8:110593173-110593195 TCACATGGTAGAAGAGGCAAGGG + Intergenic
1046183171 8:110679111-110679133 GCTCTAGGAAGAAGAGGAACAGG - Intergenic
1047118518 8:121872887-121872909 CCTCTAGGTAAAAGTGGAACTGG - Intergenic
1047239039 8:123068855-123068877 AATCATGGTGGAAGGGGAACAGG + Intronic
1047519151 8:125581100-125581122 ACTCATGGTAGAAGGTGAAGGGG + Intergenic
1048217399 8:132508996-132509018 ACTCATGGTGGAAGGGGAAGGGG + Intergenic
1048251589 8:132870716-132870738 ACTCATGGTACAAGGGGAAGAGG + Intronic
1049195411 8:141313033-141313055 CCTCATGGCAGGAGAGCACCAGG - Intergenic
1051306560 9:15716685-15716707 TCTCATGGTAGAAGATGAAAGGG + Intronic
1051464773 9:17365302-17365324 ATTCATGGCAGAAGGGGAACAGG - Intronic
1052338665 9:27343664-27343686 CCTCATAATAAAAGACGAACAGG - Intronic
1052350711 9:27455748-27455770 CCTAAAGGTAGAAGAGAAAAGGG + Exonic
1053449836 9:38184161-38184183 CCTCATGGCAGAAGGAGAAGGGG + Intergenic
1053519603 9:38764397-38764419 CATCATGGTGGAAGATGAACAGG - Intergenic
1053581206 9:39406298-39406320 ACTCATGGCAGAAGATGAAGGGG - Intergenic
1053845691 9:42234362-42234384 ACTCATGGCAGAAGATGAAGGGG - Intergenic
1054102793 9:60965102-60965124 ACTCATGGCAGAAGATGAAGGGG - Intergenic
1054583565 9:66941758-66941780 ACTCATGGCAGAAGATGAAGTGG + Intergenic
1056052076 9:82779319-82779341 AATCATGGCAGAAGATGAACAGG + Intergenic
1056257177 9:84811926-84811948 CCTCCTGATAAAAAAGGAACAGG - Intronic
1057589078 9:96356172-96356194 CCTCCTGGCAGAAGGGGAAGGGG - Intronic
1058139277 9:101340852-101340874 ACTCATGGTAGAAGGAGAAGGGG + Intergenic
1059573085 9:115461087-115461109 TTCCATGGTAGAATAGGAACAGG + Intergenic
1059825803 9:118027554-118027576 ACTCATGGCAGAAGATGAAGGGG - Intergenic
1059905742 9:118983737-118983759 GCTCATGGCAGAAGATGAAGGGG + Intergenic
1060474111 9:123974348-123974370 CTTCAGGGTAAAAGAGGAATGGG + Intergenic
1062396194 9:136353806-136353828 CCTCCTGGTCTAAAAGGAACTGG - Intronic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1185804441 X:3044548-3044570 GCTCTTGGTGGAAGAGGAGCTGG + Intronic
1185913937 X:4014037-4014059 ACTCATGGTAAAAGAAGAAGAGG + Intergenic
1186086140 X:5992711-5992733 ACTTATGGTGGAAGAGGAAGGGG + Intronic
1186449573 X:9660952-9660974 CCACATGGTAGAAGGGGCAAAGG - Intronic
1186529650 X:10282353-10282375 ATTCATGGCAGAAGAGGAAGGGG + Intergenic
1187312231 X:18156211-18156233 CCTCATGGTGGAAGAGGCGAGGG - Intergenic
1187529979 X:20087433-20087455 ACTCATGGTGGAAGGGGAAGGGG - Intronic
1188158798 X:26775524-26775546 AATCATGGTAGAAGGGGAAGAGG - Intergenic
1188553317 X:31384180-31384202 CCTCATGGGAGAGGAAGCACAGG - Intronic
1188776102 X:34220938-34220960 ACTCATGGCAGAAGAGGAAGTGG + Intergenic
1189011947 X:37054423-37054445 GCTCATGGCAGAAGACAAACTGG - Intergenic
1189036759 X:37501862-37501884 GCTCATGGCAGAAGACAAACTGG + Intronic
1189426982 X:40910513-40910535 GCTCATGGCAGAAGGGGAAGAGG + Intergenic
1189858742 X:45250848-45250870 ACTCATGGTAGAAGGTGAAAGGG + Intergenic
1190277206 X:48906508-48906530 CCTCATGGAGGAAGAGAACCAGG + Exonic
1191845736 X:65546493-65546515 TCACATGGTAGAAGAGCAAAAGG + Intergenic
1192092721 X:68177636-68177658 CATCATGGTAGAAGATGAAGGGG + Intronic
1192961625 X:76137536-76137558 CCTCATTCTAGATGAGGAAATGG + Intergenic
1193090227 X:77486168-77486190 AATCATGGCAGAAGGGGAACAGG + Intergenic
1193236481 X:79113601-79113623 CTTCATGGAAGAAGGGGAAGTGG + Intergenic
1193984152 X:88219937-88219959 CCACATGGTAGAAGGTGAAAGGG + Intergenic
1194401459 X:93441859-93441881 AATCATGGTGGAAGAGGAAGAGG - Intergenic
1194414988 X:93601126-93601148 ACTCATGGCAGAAGAGGAAGAGG - Intergenic
1194465339 X:94228323-94228345 ACTCATGGTAGAAGGTGAAGAGG + Intergenic
1194947017 X:100081168-100081190 ACTCATGGTAGAAGTTGAAGGGG - Intergenic
1195943213 X:110182189-110182211 TTTCATGGGAGAAGAGGAAGAGG - Intronic
1196103118 X:111868200-111868222 CCTCATAGAAGCAGAGGATCTGG + Intronic
1196362191 X:114875126-114875148 TCACATGGTAGAAGAGGTAAGGG + Intronic
1196903383 X:120408968-120408990 AATCATGGCAGAAGAGGAAGAGG + Intergenic
1197380651 X:125734854-125734876 CCTCAAGGTAGAAAAGTCACTGG - Intergenic
1197866319 X:131022420-131022442 ACTCATGGCAGAAGGCGAACGGG - Intergenic
1198093664 X:133356624-133356646 ACTCATGGTGGAAGGGGAAGGGG - Intronic
1198314286 X:135451073-135451095 ACTCATGGTAGAAGGTGAAGGGG + Intergenic
1198630271 X:138629575-138629597 CATCATGGCAGAAGATGAAGGGG - Intergenic
1199617623 X:149670521-149670543 GCCCATGGGAGAAGAGGAAAAGG - Intergenic
1199625020 X:149732728-149732750 GCCCATGGGAGAAGAGGAAAAGG + Intergenic
1199683666 X:150245007-150245029 CCTCATGGTAGCATAGGACAGGG - Intergenic
1200737125 Y:6812023-6812045 CCTCCTGGTAACAGGGGAACAGG + Intergenic
1200776057 Y:7171288-7171310 CTTCATGGTCTAAGAGGAAAGGG + Intergenic
1201336022 Y:12880619-12880641 ACTCATGGCAGAAGATGAAGCGG - Intergenic
1201396317 Y:13552893-13552915 CCACATGGTGGAAGTGGACCTGG - Intergenic
1201446685 Y:14064599-14064621 TCACATGGTAGAAGGGGAAAGGG - Intergenic
1201719647 Y:17082570-17082592 CGTCATGAAAGAGGAGGAACAGG - Intergenic
1202391437 Y:24374397-24374419 CCTCATGCTACCAGAGGACCTGG - Intergenic
1202479348 Y:25295720-25295742 CCTCATGCTACCAGAGGACCTGG + Intergenic