ID: 1129011736

View in Genome Browser
Species Human (GRCh38)
Location 15:72424606-72424628
Sequence AATTGTGTTAAATGCTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129011735_1129011736 -1 Left 1129011735 15:72424584-72424606 CCACAAATAATTACTTAGTTACA No data
Right 1129011736 15:72424606-72424628 AATTGTGTTAAATGCTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129011736 Original CRISPR AATTGTGTTAAATGCTAAGA AGG Intergenic
No off target data available for this crispr