ID: 1129012612

View in Genome Browser
Species Human (GRCh38)
Location 15:72436178-72436200
Sequence CAGTTTTTCACCACTGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129012611_1129012612 0 Left 1129012611 15:72436155-72436177 CCTGGTCTTGGAGGAAAAGCTTT No data
Right 1129012612 15:72436178-72436200 CAGTTTTTCACCACTGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129012612 Original CRISPR CAGTTTTTCACCACTGAGTA TGG Intergenic
No off target data available for this crispr