ID: 1129018260

View in Genome Browser
Species Human (GRCh38)
Location 15:72488982-72489004
Sequence TCCCAAAGTTGTGGGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613137
Summary {0: 3, 1: 265, 2: 15165, 3: 337369, 4: 260335}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129018260_1129018269 26 Left 1129018260 15:72488982-72489004 CCTGCAATCCCACAACTTTGGGA 0: 3
1: 265
2: 15165
3: 337369
4: 260335
Right 1129018269 15:72489031-72489053 CCAGGAGTTTGAGACCAGCCTGG 0: 18758
1: 81811
2: 152089
3: 186177
4: 177040
1129018260_1129018265 -8 Left 1129018260 15:72488982-72489004 CCTGCAATCCCACAACTTTGGGA 0: 3
1: 265
2: 15165
3: 337369
4: 260335
Right 1129018265 15:72488997-72489019 CTTTGGGAGGTTGAGGCCAGAGG 0: 15
1: 549
2: 5174
3: 61965
4: 157681
1129018260_1129018270 27 Left 1129018260 15:72488982-72489004 CCTGCAATCCCACAACTTTGGGA 0: 3
1: 265
2: 15165
3: 337369
4: 260335
Right 1129018270 15:72489032-72489054 CAGGAGTTTGAGACCAGCCTGGG 0: 19126
1: 38854
2: 56666
3: 50459
4: 31838
1129018260_1129018267 8 Left 1129018260 15:72488982-72489004 CCTGCAATCCCACAACTTTGGGA 0: 3
1: 265
2: 15165
3: 337369
4: 260335
Right 1129018267 15:72489013-72489035 CCAGAGGATTACTTGAGTCCAGG 0: 2
1: 53
2: 767
3: 6758
4: 38926

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129018260 Original CRISPR TCCCAAAGTTGTGGGATTGC AGG (reversed) Intronic
Too many off-targets to display for this crispr