ID: 1129022932

View in Genome Browser
Species Human (GRCh38)
Location 15:72539817-72539839
Sequence CTCTATATGAATATTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129022929_1129022932 15 Left 1129022929 15:72539779-72539801 CCTCAGTAACAACAGGTAACAAG 0: 1
1: 0
2: 0
3: 21
4: 166
Right 1129022932 15:72539817-72539839 CTCTATATGAATATTGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 156
1129022927_1129022932 23 Left 1129022927 15:72539771-72539793 CCAGACTTCCTCAGTAACAACAG 0: 1
1: 0
2: 0
3: 18
4: 140
Right 1129022932 15:72539817-72539839 CTCTATATGAATATTGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129022932 Original CRISPR CTCTATATGAATATTGAGGA GGG Intronic
905629729 1:39511883-39511905 CTCTATGTGGAGACTGAGGACGG + Exonic
905668030 1:39774307-39774329 CTCTATGTGGAGACTGAGGACGG - Exonic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
910449307 1:87330027-87330049 CTCTAAATGAAACTTGATGAGGG + Intronic
918086917 1:181253291-181253313 CTGTATAGGAATATTCAGGCTGG - Intergenic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
924652455 1:245941817-245941839 TTCTTTAAGAATATTGAGGCAGG - Intronic
1065488592 10:26258460-26258482 CTGGAGATGAATATTGATGATGG - Intronic
1066120985 10:32287063-32287085 TTCTCTATGAACATTGAGGAGGG - Intronic
1067983912 10:51120268-51120290 AACTATATGAATATTAGGGAGGG + Intronic
1070956492 10:80467146-80467168 CTCTATTTTAATATTAATGATGG + Intronic
1072997814 10:100261587-100261609 CTCTATATGAATGTTGTGTATGG - Intronic
1073277513 10:102325246-102325268 CTCTATACGAATGCTGAGAAGGG + Intronic
1073919641 10:108444019-108444041 CTATATATGAATGTTTAGGGTGG - Intergenic
1073982198 10:109167338-109167360 CTCTTAGTGAGTATTGAGGAAGG - Intergenic
1074044276 10:109822319-109822341 CTCTCTTTCAAAATTGAGGATGG - Intergenic
1074551447 10:114446066-114446088 TTCTATTTGAAAATTGAGGCTGG - Intronic
1076286144 10:129298351-129298373 CTGTATATGAAAAGTGAGTATGG + Intergenic
1077732120 11:4742590-4742612 ATATATATAAAAATTGAGGAAGG - Intronic
1079506981 11:21163886-21163908 CAATATATGAATTTTGAGGGGGG + Intronic
1080707693 11:34713455-34713477 CTCTATTAGAACAGTGAGGAGGG + Intergenic
1082231254 11:49769567-49769589 ATCTAGATAAATGTTGAGGATGG + Intergenic
1084772990 11:71356593-71356615 CTCTATTTGAAGGTAGAGGAAGG - Intergenic
1085117562 11:73943648-73943670 CTCTATTTCAATATTTAGGAAGG - Intergenic
1085910434 11:80818466-80818488 ATATATATGAATATTATGGAAGG - Intergenic
1086618789 11:88859407-88859429 ATCTAGATAAATGTTGAGGATGG - Intronic
1087968211 11:104445953-104445975 ATCTAGAAGAAAATTGAGGAAGG - Intergenic
1088089442 11:106021610-106021632 CCCTATAAGAATATAGGGGAGGG - Exonic
1089246730 11:117126608-117126630 CTTGATAGGAACATTGAGGAAGG + Intergenic
1091808195 12:3371818-3371840 CTATTAATGAATATTTAGGATGG + Intergenic
1096205820 12:49720883-49720905 ACCTATATGCATATTCAGGAAGG - Intronic
1098667346 12:73180509-73180531 TTCTATATGAGTATTGCTGATGG + Intergenic
1101419169 12:104535207-104535229 CTCTATGAGAATATCAAGGACGG - Intronic
1103044368 12:117723125-117723147 CTCTTTGTGAATGGTGAGGATGG - Intronic
1103954685 12:124569348-124569370 CTCTATTTGAAGCTGGAGGAGGG + Intergenic
1105334473 13:19453383-19453405 CTATATATGTATACTAAGGAAGG - Intronic
1106484815 13:30162778-30162800 CTATAAAGGAATATTGAGGCTGG + Intergenic
1106787868 13:33124979-33125001 CTCTAAATTAAAAATGAGGAGGG + Intronic
1107488687 13:40858358-40858380 CTATATATGTATACTAAGGAAGG - Intergenic
1109272563 13:60270874-60270896 CTCTATGTAAAGATTGGGGAAGG - Intergenic
1109712165 13:66176128-66176150 CTTTATATGTATATAAAGGAGGG + Intergenic
1109791712 13:67257580-67257602 CTATACATGACTATTGATGAAGG - Intergenic
1110846912 13:80200287-80200309 ATCTCTATGAATATTTAGCAAGG - Intergenic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1113303441 13:109049198-109049220 CTCTATATAAATACTGAGAGCGG - Intronic
1113959171 13:114116317-114116339 CTCTAGGTTAATAGTGAGGACGG - Intronic
1114229047 14:20764003-20764025 CTATATATTAAGACTGAGGAGGG - Intergenic
1115126083 14:29995769-29995791 CTTTATATGAATCTTAAAGATGG + Intronic
1115461046 14:33661233-33661255 CTTTATTTTAATATTAAGGAAGG - Intronic
1117697514 14:58380921-58380943 CTATATATGAATATTTATGCTGG - Intergenic
1117764840 14:59071146-59071168 CTCTAAATGCATACTGATGATGG - Intergenic
1118788458 14:69066656-69066678 CTTTATCTGAATTTTGAGCAAGG - Intronic
1120766673 14:88333709-88333731 CTTTATATGAATTTTAAGGAGGG - Intergenic
1124819360 15:33029140-33029162 TTCTTTATGTATTTTGAGGAAGG - Intronic
1126218959 15:46190044-46190066 CTCATTATGAGTTTTGAGGAGGG - Intergenic
1126682588 15:51217218-51217240 CTCTCTATGAATTTAGAGGCTGG - Intronic
1127196990 15:56597961-56597983 CTCAATATAAATATTGAAAAAGG + Intergenic
1128784933 15:70387981-70388003 CTAAATGAGAATATTGAGGAAGG + Intergenic
1129022932 15:72539817-72539839 CTCTATATGAATATTGAGGAGGG + Intronic
1129099506 15:73246449-73246471 CTCTATATGAAAGCTGATGAAGG - Intronic
1130176428 15:81576290-81576312 TTCTATATTAAAATTAAGGAGGG + Intergenic
1131176853 15:90214689-90214711 CTCCTTATGGACATTGAGGATGG + Intronic
1135746061 16:25017381-25017403 CTCAAAAAGAATATTGAGGCTGG + Intergenic
1137950282 16:52777011-52777033 CTTAATATAAATATTGAGGAGGG + Intergenic
1138905275 16:61323917-61323939 CTCATTTTGAATATTGAGTAAGG - Intergenic
1157109064 18:44802574-44802596 CTCAAGATGAATGCTGAGGAAGG - Intronic
1157868769 18:51210142-51210164 CCCTAGATGAATAATGTGGATGG + Intronic
1157941320 18:51931900-51931922 CTGAATCTGAATATTGAGAACGG + Intergenic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158328884 18:56339691-56339713 CTCTGTCTGAATATGGAGCAGGG - Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
925508973 2:4603291-4603313 CTCTTTATGAAAACTGAGGCTGG + Intergenic
928818485 2:35329249-35329271 AACTATATGAATATTCAGGGAGG - Intergenic
929061528 2:37929959-37929981 TATTATGTGAATATTGAGGAAGG + Intronic
941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG + Intronic
942942576 2:181636520-181636542 CTCAACCTGAAAATTGAGGAAGG - Intronic
943659302 2:190540766-190540788 CTCTTTTTAAAAATTGAGGAGGG - Intergenic
944617205 2:201473693-201473715 CCCTATGTGACTATTTAGGATGG - Intronic
945009936 2:205450229-205450251 CTAAATATAACTATTGAGGAAGG + Intronic
945015158 2:205507508-205507530 GTCTATAAGAATATTGTGGCCGG - Intronic
945724358 2:213457185-213457207 CCCTATTTGACTATTTAGGATGG + Intronic
946398736 2:219457263-219457285 CTCCTTATGATTCTTGAGGAAGG - Intronic
1169859120 20:10132970-10132992 CTCTCTATGAACACTGGGGAAGG - Intergenic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1171230961 20:23484668-23484690 GACTATTTGAATGTTGAGGAGGG + Intergenic
1171304758 20:24095707-24095729 CTCTCTAAGAATATTGAAAAGGG + Intergenic
1178001882 21:28169723-28169745 CTCTATATAAATATTTTGAACGG + Intergenic
1185184235 22:49383070-49383092 TTCAATATGAAAATTGAGGGAGG + Intergenic
957710187 3:83847295-83847317 CTCTAGATGAATATGCAGCATGG - Intergenic
957904393 3:86538677-86538699 CTTTTTCTGAAGATTGAGGATGG + Intergenic
958771950 3:98435755-98435777 CTCTTTATGACTAGTGATGAGGG - Intergenic
959469274 3:106729600-106729622 TTTTCTTTGAATATTGAGGAAGG - Intergenic
959479602 3:106855032-106855054 TTCTTTAAGAATATTGAGGCTGG - Intergenic
960310807 3:116114141-116114163 GTCTATAGGAATGATGAGGAAGG - Intronic
960641396 3:119827317-119827339 ATCTCTATGAATAATGAAGAGGG - Intronic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
965150439 3:164967329-164967351 CATTATAAGAATATTGAAGATGG + Intergenic
966662940 3:182434754-182434776 GTCTATATGAATTTGGAGAAGGG + Intergenic
966994590 3:185267259-185267281 CTCTATTTTAATATTAAGGCTGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967617433 3:191588333-191588355 CTATAGATTAATATTAAGGAAGG + Intergenic
967703432 3:192621216-192621238 CTCTATAAAATTTTTGAGGAAGG - Intronic
974573811 4:63689878-63689900 CTCAATATGAAAATTGAGTGAGG - Intergenic
975833897 4:78400240-78400262 CTCTATAAGAAGCTTGAGCAGGG - Intronic
976084947 4:81398262-81398284 CTCTTTATTTATATTGAGGCAGG + Intergenic
977409045 4:96637948-96637970 CTCTACATGAATATTTACTATGG - Intergenic
978584869 4:110266715-110266737 ATCTATATGAATCTTGAGAAGGG + Intergenic
979541851 4:121892803-121892825 CTCTATTTGAATTTTAAGGTGGG - Intronic
979810209 4:125027318-125027340 ATCTATATGAATATACATGAAGG - Intergenic
980145349 4:128976617-128976639 CGCTATAGTAATCTTGAGGAGGG + Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
984464005 4:180074669-180074691 ATCTATATGATTATTGAAAAAGG + Intergenic
985298756 4:188464358-188464380 CTGGATATGGATATTGATGACGG + Intergenic
985418873 4:189763594-189763616 CTCTATCTGCATACTGAGGGTGG - Intergenic
985854599 5:2415246-2415268 CCCCATATGAATATTTAGAATGG + Intergenic
986167933 5:5291905-5291927 CTGTATATGTGAATTGAGGAGGG + Intronic
987364240 5:17134534-17134556 CTGTATAAGAATATTCAGGCCGG - Intronic
990345169 5:54864824-54864846 TTCTATAGGAATACTGTGGAAGG + Intergenic
993972864 5:94441481-94441503 CAACATATGAATTTTGAGGAGGG - Intronic
994716668 5:103329711-103329733 CAACATATGAATATGGAGGAGGG + Intergenic
994746007 5:103679259-103679281 CTCCATATAAAAATTGAAGAAGG - Intergenic
995838173 5:116418881-116418903 CTATAGATGAATATTGAGCCAGG - Intergenic
998619150 5:143775174-143775196 CTTTATATGAATACTAATGAGGG - Intergenic
999776847 5:154818772-154818794 CTCTTTAAGCATATTGAAGATGG + Exonic
1000085018 5:157881202-157881224 ACTTATATGAATAGTGAGGAAGG - Intergenic
1003555557 6:7136928-7136950 CTTGATAGAAATATTGAGGAGGG + Intronic
1004361823 6:14978028-14978050 CACTATAAGAATAATGAGGTTGG - Intergenic
1004778172 6:18872541-18872563 TTCTATATGAATATTTAGTTGGG + Intergenic
1006325237 6:33348688-33348710 CTTTTTCTGAAGATTGAGGATGG - Intergenic
1008900580 6:56610700-56610722 CTGTATATGAAAATTAAGAATGG + Intronic
1009270427 6:61606740-61606762 CTAGATCTGGATATTGAGGAGGG + Intergenic
1011354529 6:86460381-86460403 GGATATATGAATATTGATGAAGG - Intergenic
1011554258 6:88558088-88558110 CTATATATTAAAAATGAGGAAGG - Intergenic
1012133859 6:95530974-95530996 CTGTATATAAGAATTGAGGAGGG - Intergenic
1012301173 6:97590270-97590292 AACTATATGAATAAGGAGGAAGG - Intergenic
1014006104 6:116420265-116420287 TTCAATATAAATTTTGAGGAGGG - Intronic
1014610282 6:123535131-123535153 TTCTATTTGAATTTTGAGAAGGG + Intronic
1016700469 6:147048496-147048518 CTCCATATTTATATTGTGGAAGG - Intergenic
1016769044 6:147828264-147828286 CTCCATGTGAATAATCAGGAAGG + Intergenic
1017434392 6:154402310-154402332 ATCTATATGAATATTGGGCGGGG - Exonic
1024847765 7:53668899-53668921 CTCCACATGAATTTTTAGGATGG + Intergenic
1026594565 7:71723666-71723688 CTCTAAATGAATTGTGAGGTTGG - Intergenic
1028591103 7:92496261-92496283 CTGTATATGAATACAGAAGATGG - Intronic
1032636295 7:133712880-133712902 ATCTATATGAATATCCAGAATGG + Intronic
1033108111 7:138549278-138549300 CTACATATGAATGTAGAGGAAGG + Intronic
1037457569 8:19079107-19079129 CTGTGTGTGAATGTTGAGGATGG + Intronic
1037681526 8:21101560-21101582 CTCTGTATGTGTATTGGGGATGG + Intergenic
1041657127 8:60363998-60364020 CAGCATATGAATTTTGAGGAAGG + Intergenic
1043210623 8:77511116-77511138 AAATATATGAATATTGAGTATGG + Intergenic
1044952449 8:97447503-97447525 CTCTACATTAAGATTGAGAAGGG - Intergenic
1045838552 8:106552391-106552413 CTCTATATGAATATTCTGTGTGG + Intronic
1046155416 8:110283544-110283566 TTCTATATGAATTTCCAGGAGGG - Intergenic
1051925528 9:22320516-22320538 ATATATATGAATTTTGGGGATGG - Intergenic
1052224258 9:26065646-26065668 CATTAGGTGAATATTGAGGATGG - Intergenic
1053103091 9:35387989-35388011 TTCAATCTGAATTTTGAGGAAGG + Intronic
1057205983 9:93173037-93173059 CTCCATGTGAATATAGAAGAGGG - Intergenic
1186420157 X:9419231-9419253 GTCTATTAGAAAATTGAGGATGG - Intergenic
1187549666 X:20289409-20289431 CTCTACATGAATACTGTAGATGG + Intergenic
1192486459 X:71531321-71531343 CTCTCTATGAATATCTAGGGAGG - Intronic
1192679446 X:73236601-73236623 GTATCTATGAATATTCAGGAAGG - Intergenic
1193428058 X:81364739-81364761 CTATATATCAAGATTGAGTATGG + Intergenic
1196220294 X:113105967-113105989 ATTTCTATGAATATTGAAGAAGG + Intergenic
1197322997 X:125056309-125056331 CTCAATATGAATGGTGAGAATGG + Intergenic
1202597332 Y:26554798-26554820 CTATATATGTATACTAAGGAAGG + Intergenic