ID: 1129025264

View in Genome Browser
Species Human (GRCh38)
Location 15:72566239-72566261
Sequence AAAAATGCACTGATGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129025260_1129025264 27 Left 1129025260 15:72566189-72566211 CCTACAAAGTCAGCCTTTTATTC 0: 1
1: 0
2: 0
3: 22
4: 217
Right 1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG 0: 1
1: 0
2: 2
3: 27
4: 313
1129025263_1129025264 14 Left 1129025263 15:72566202-72566224 CCTTTTATTCTTCATTTAGGGTG 0: 1
1: 1
2: 1
3: 49
4: 436
Right 1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG 0: 1
1: 0
2: 2
3: 27
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129025264 Original CRISPR AAAAATGCACTGATGAAGCA TGG Intronic
901129946 1:6955935-6955957 AAGCATGCACTGAGGAGGCAAGG + Intronic
901560316 1:10065102-10065124 AAAAATAAACTGATGAATCTAGG - Intronic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
903064549 1:20691762-20691784 AAAAATGCACTGAGCAGGCTGGG - Intronic
903768824 1:25751353-25751375 AAAAATGCAGGGAAGATGCATGG - Intronic
903796977 1:25936711-25936733 AGCAATGCACTGATGGAACAGGG + Intergenic
904844083 1:33395565-33395587 AAAGATGAACTGATGATGGATGG + Intronic
905066161 1:35185341-35185363 AAAGATGGACTGATGAAGGTGGG - Intronic
906754997 1:48303370-48303392 AAAAATACAGTTATGAAGAAGGG - Intronic
907306166 1:53514245-53514267 CCAAATGCACAGATGAGGCAAGG + Intronic
908383875 1:63622033-63622055 AAACATGCACTGAGGAATTAAGG - Intronic
909353538 1:74681219-74681241 AAAAATGCTCTGATGAGCCAAGG + Intergenic
909504440 1:76372253-76372275 AAAACTGAAATGATGAGGCAAGG - Intronic
909584469 1:77274179-77274201 AAATATGCTTTTATGAAGCAAGG - Intergenic
910609367 1:89124928-89124950 AAACATTCTCTGATGAACCAGGG + Intronic
911169339 1:94754882-94754904 AAAAACGCATTGGTGAAGGAGGG - Intergenic
912166494 1:107047742-107047764 CAAAATGCACAAATAAAGCAAGG + Intergenic
912616893 1:111110812-111110834 AAAAATGCATTGAAGAAGGTAGG - Intergenic
912657381 1:111499262-111499284 ACAAATGCTCTGATGAACCCAGG + Intronic
914821073 1:151103569-151103591 AAAACTGTACTGTTGAGGCATGG - Exonic
916895221 1:169155328-169155350 AACAAAGCAGTGATGAAGCAAGG + Intronic
917114881 1:171592981-171593003 AAAACAGCTCTGATAAAGCACGG - Exonic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917810652 1:178655096-178655118 AAAAAGGCACTACTTAAGCAGGG + Intergenic
917893933 1:179467754-179467776 CAAAATTTACTGATGAAGGAAGG + Intronic
918847680 1:189639592-189639614 AGAAATGGAGTGATGAAGGATGG + Intergenic
919585806 1:199438156-199438178 AACAATGCAATAAGGAAGCAGGG - Intergenic
920720802 1:208385031-208385053 AAAAATGGACTCATCAGGCAAGG + Intergenic
921420030 1:214935995-214936017 AAAAATACAGTGATAAATCAAGG - Intergenic
921769508 1:219019553-219019575 AAAAATGAACTGATCCAGTATGG + Intergenic
923496242 1:234527860-234527882 AAAAAGGCAATGATTAAACAAGG + Intergenic
923637707 1:235717535-235717557 GAAAAAGCTCTGATGAAGAAGGG + Intronic
1063856136 10:10256226-10256248 TAAAATGCACACATAAAGCATGG - Intergenic
1063874753 10:10462456-10462478 AAAAAGGCAAAGAAGAAGCAGGG - Intergenic
1065481428 10:26197860-26197882 ATAAATGCACTGAAGAAGGCTGG - Intronic
1065616641 10:27533898-27533920 ATAAATGCAATGATTAAGAAAGG - Intronic
1066587482 10:36952226-36952248 AAAAATGAAATGAAGGAGCATGG - Intergenic
1068872367 10:61959058-61959080 AATATTGCAGTGATGAATCATGG - Intronic
1072666595 10:97397662-97397684 AAAAATAAACTAATCAAGCAGGG + Intronic
1074155838 10:110798574-110798596 AAAAAGGCACTGAGAAAGCTGGG + Intronic
1075347050 10:121690506-121690528 TACAATGCACTGATTAATCATGG + Intergenic
1077133220 11:985339-985361 AAAAATGCTCTCATGATGTATGG + Intronic
1078737359 11:14032852-14032874 AAATATGCACTGTTGAGTCAGGG - Intronic
1080053095 11:27876842-27876864 AAAAAAGTACTTATTAAGCAAGG - Intergenic
1081405979 11:42698265-42698287 AAAAAGGCAGGGAGGAAGCAAGG + Intergenic
1085288913 11:75383388-75383410 AAAACAGCTCTGATGTAGCAAGG + Intergenic
1085914624 11:80870465-80870487 TAAAATGGACTAATGAAGAAAGG + Intergenic
1086876551 11:92103368-92103390 TAAAATGCACAGAGGATGCAGGG - Intergenic
1087128624 11:94650433-94650455 CAAAATGCACAAATGAGGCAAGG - Intergenic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1089201718 11:116728582-116728604 ATAAATGAACTGATGAAGATGGG + Intergenic
1090115102 11:123962357-123962379 AAAAATGCAATGATGGAGTAAGG + Intergenic
1090562886 11:127951772-127951794 AAAAAGGCATTGATAAACCAAGG - Intergenic
1090638595 11:128710241-128710263 AAAAATGAAGAGATGAAGAAAGG + Intronic
1092042505 12:5397072-5397094 AAAAATGAAGTAATGAATCAAGG - Intergenic
1092063049 12:5566163-5566185 AAGAATGCAGCCATGAAGCAAGG - Intronic
1092094585 12:5831142-5831164 GAGGATGCACTGATGAAGGAAGG + Intronic
1092587377 12:9912978-9913000 AAAACTGCACTAATGCAACAAGG + Intronic
1093423637 12:19003186-19003208 TTAAATGCACTGATTATGCAAGG + Intergenic
1093914859 12:24790113-24790135 AAACATGTACACATGAAGCATGG + Intergenic
1094380886 12:29841503-29841525 AAAGAGGCACTGAAGAAGCCAGG - Intergenic
1095189855 12:39245094-39245116 AACAATGCATTGATTGAGCAAGG + Intergenic
1097486345 12:60207111-60207133 AATAATGCATAGAGGAAGCAAGG + Intergenic
1097589257 12:61553552-61553574 AAAACTTCACTGCTGAAGGAAGG + Intergenic
1097754117 12:63390128-63390150 CAAAATGCACAAATAAAGCAAGG - Intergenic
1098228331 12:68347713-68347735 AAAAATACACTGAAGACCCAAGG + Intergenic
1098493061 12:71104765-71104787 AAAAATGAACTGTTTAAGTATGG - Intronic
1098516615 12:71384636-71384658 AAAGATGCACTGAATAAGCCAGG - Intronic
1098588897 12:72186602-72186624 ACAATTTCACTGAAGAAGCAAGG + Intronic
1098828069 12:75324098-75324120 CAAAATACACTGAAGAAACATGG + Intronic
1102713159 12:114946198-114946220 AAAAATACAGAGATCAAGCAGGG + Intergenic
1103191884 12:119008732-119008754 AAAACAGCACTGATGAGGGAGGG - Intronic
1103741236 12:123092965-123092987 AAAAATGCACTTGTGATCCATGG + Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1105759550 13:23501434-23501456 AAAAATGAACTGATTCAGGATGG + Intergenic
1105773679 13:23636826-23636848 AAAAATGCTCTGCTGAAACTAGG - Intronic
1105979522 13:25504161-25504183 AAAACTGGACTGAGGTAGCAGGG - Intronic
1106575246 13:30968405-30968427 GAATCTGCACTGATGAAGCCTGG - Intronic
1108276841 13:48819510-48819532 AAAAATGCTCTTAAGATGCATGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108918639 13:55648920-55648942 CAAAATGAAATGGTGAAGCAGGG - Intergenic
1109106055 13:58252442-58252464 ATAAATGCTCTGTTGAAACAAGG - Intergenic
1109898799 13:68734191-68734213 CAAAATGAAATGATGAGGCATGG - Intergenic
1111031637 13:82607614-82607636 AAAATTGCACTGATGATTAAGGG + Intergenic
1111344197 13:86926935-86926957 AAAAATGGACTAATACAGCAGGG - Intergenic
1111674933 13:91375392-91375414 AAACATGCAGTGATGAAGACAGG - Intergenic
1111942161 13:94622009-94622031 AAAAATGTATTAATGAAGGATGG + Intronic
1112243895 13:97710560-97710582 CAACATGCAGTGATGGAGCAGGG - Intergenic
1112247934 13:97751235-97751257 TAAATTGCCCTGATGAAGTAGGG + Intergenic
1113148864 13:107239859-107239881 AAACAAGCACTTATGAAGCAGGG + Intronic
1113470306 13:110539853-110539875 AAAAATGCATTGATGTGGCCGGG - Intronic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1116726510 14:48566972-48566994 CAAAATGCACACATAAAGCAAGG + Intergenic
1119185072 14:72634853-72634875 ATAAATGCTCTGTTGAATCATGG - Intronic
1119284962 14:73445881-73445903 ATAAATGTACTGATGAATGATGG - Intronic
1120484926 14:85101505-85101527 AAAAATGAACAAATGAAACAAGG - Intergenic
1123492558 15:20793889-20793911 AAAAGTGCAAGGATGAAGAAGGG + Intergenic
1123549059 15:21362981-21363003 AAAAGTGCAAGGATGAAGAAGGG + Intergenic
1127561910 15:60146881-60146903 ACAAAGGCACTGAAGAATCATGG - Intergenic
1128759993 15:70210074-70210096 ATAAATAGACTGATGAAGGAGGG + Intergenic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1131576160 15:93593468-93593490 CAAAATTCACTGCTGAAGCTGGG - Intergenic
1202957393 15_KI270727v1_random:90202-90224 AAAAGTGCAAGGATGAAGAAGGG + Intergenic
1134630790 16:15754505-15754527 AAAAATCCACTGATGAAGTAGGG + Intronic
1134895255 16:17880617-17880639 AAACATGCCCTGATGAAGATAGG + Intergenic
1135198528 16:20415884-20415906 TAAAATACAATGATGAAGTAGGG - Intronic
1135636867 16:24085087-24085109 AGCAATGCACTGATGGACCAGGG + Intronic
1135981852 16:27153959-27153981 AATAATGGCCTGATGAAGTAGGG + Intergenic
1137840801 16:51639177-51639199 AAAAATGCTCTGATGAAATCAGG + Intergenic
1139290976 16:65857569-65857591 AAAAATTCAGTGATGAAGATAGG - Intergenic
1140212855 16:72984329-72984351 AAAAATTCACTGGTGAGGCCAGG + Intronic
1140810354 16:78571145-78571167 GAAAATCCACTGAGGAAGAAAGG + Intronic
1143314218 17:6019622-6019644 AAAAATGTACTCATGCAACAGGG - Intronic
1143375563 17:6464820-6464842 AACACTGCAATGATAAAGCAAGG - Intronic
1145020521 17:19426943-19426965 AAATCTGCACTGACGAAGCCGGG - Intergenic
1145021312 17:19433600-19433622 AAATCTGCACTGATGAAGCCAGG - Intergenic
1147547183 17:41411079-41411101 AAAAATCCACTGCTGACCCAGGG + Intergenic
1148628159 17:49086283-49086305 AAAAACTCACTGATTAAACAGGG - Intergenic
1150135063 17:62690918-62690940 AAGAAGGCACTGAGGGAGCAGGG - Intronic
1150413478 17:64966953-64966975 AAAAAGAGACTGATGGAGCATGG - Intergenic
1150658665 17:67057002-67057024 AGAAACCCTCTGATGAAGCAAGG + Intergenic
1150798342 17:68258281-68258303 AAAAAGAGACTGATGGAGCATGG + Intergenic
1152972256 18:173832-173854 ACAAAGGCACTGAGGAAGAATGG - Intronic
1153778283 18:8472837-8472859 AAGAATTCCCTGATGAAGAAAGG - Intergenic
1153987846 18:10368868-10368890 AGACATGCAGTGATGAGGCAGGG - Intergenic
1158617311 18:59000211-59000233 AAAAATGCCATCATGAAGCTGGG - Intergenic
1158879966 18:61768635-61768657 AAAAATGGACTGATACACCAAGG + Intergenic
1159940948 18:74407986-74408008 AAAAAGGAAATGATGAAGAAAGG - Intergenic
1161291336 19:3494961-3494983 AAAAATGGACTGTTGTAGCGAGG - Intronic
1161503862 19:4633404-4633426 GAGAATGCACTGAAGAGGCAGGG + Intergenic
1166421809 19:42642047-42642069 AAAAATCCCCTGATGAGGCTGGG - Intronic
925466072 2:4108432-4108454 AACACTGCCCTGATGAAGCAAGG - Intergenic
926347729 2:11963854-11963876 GAAAATGCACTGAAGAAGAAAGG + Intergenic
926415686 2:12647441-12647463 CAAACTGTAATGATGAAGCATGG + Intergenic
929685808 2:44033164-44033186 AAATATGAACTGATAAATCATGG - Intergenic
929809043 2:45172902-45172924 AAAAATGTAGTGATGATGAATGG + Intergenic
930288958 2:49468877-49468899 AAAGAAGCACTGATGAGGCTAGG - Intergenic
930363940 2:50415519-50415541 GCAAATGTTCTGATGAAGCATGG + Intronic
930584017 2:53248446-53248468 AAAAATGCACTGATCTAACCGGG + Intergenic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
932946954 2:76246203-76246225 AAAAAAGCAATGAAGAAACATGG - Intergenic
932965556 2:76470979-76471001 AAGAAGGCACTGAGGAAGCAAGG + Intergenic
933318793 2:80746296-80746318 AAAAATGAACTGATTAATAAAGG + Intergenic
938470210 2:131553136-131553158 AAAAATGCACCAAAGAAGCTGGG - Intergenic
938697323 2:133846026-133846048 AGAATAGCACTGATGAAGAAAGG - Intergenic
938826572 2:135011572-135011594 AAAAATGTACTGATCAGGCACGG + Intronic
939209093 2:139148416-139148438 GAAAATGCAATGACGTAGCAAGG + Intergenic
939982867 2:148801695-148801717 AAAAATGGACTGATTAACAAAGG - Intergenic
940376734 2:152966289-152966311 AAACATTCCCTGATAAAGCATGG - Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
940830507 2:158459682-158459704 AAAAAAGCACGGGTTAAGCATGG - Intronic
941141760 2:161791688-161791710 AAAAATAAAGTGATGAAACATGG - Intronic
943693694 2:190898063-190898085 AAAAATGCACGAATAAAGAAAGG - Intronic
943823444 2:192357425-192357447 AAAACTGGAATGAGGAAGCAGGG - Intergenic
943972723 2:194431749-194431771 AAAAAAGGAATGATGAAGGATGG - Intergenic
945312001 2:208324671-208324693 AAAAATGCACTTAAGCATCATGG - Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
947193096 2:227530702-227530724 AAAAATTCACTGATTAAAAATGG - Intronic
947932480 2:233975245-233975267 GTAAATGCATTGATGAAGCACGG + Intronic
1170016624 20:11789151-11789173 AAATCTGCATTGATGCAGCATGG - Intergenic
1172566758 20:35936693-35936715 AAAAATGCAATGATTACCCAGGG - Intronic
1174288176 20:49486808-49486830 ATAAATGAACTGATGGAGAAAGG - Intergenic
1174753612 20:53136801-53136823 AAAAATCTACTGAGGAAGAAGGG + Intronic
1176446084 21:6821936-6821958 AAAAGTGCAAGGATGAAGAAGGG - Intergenic
1176824250 21:13686969-13686991 AAAAGTGCAAGGATGAAGAAGGG - Intergenic
1178003255 21:28188277-28188299 AAATAAGCACTTATGAAGAATGG + Intergenic
1178387470 21:32164919-32164941 AAAATAGCTCTGATAAAGCATGG + Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1179086995 21:38226848-38226870 GAAAATGCACTGAAGGAGGATGG - Intronic
1180582196 22:16848905-16848927 TAAAATGCACTGCTGATGCATGG + Intergenic
1180858306 22:19062166-19062188 AACAATGCACTCATAAAGCCAGG + Intronic
1181843958 22:25690986-25691008 CAACTTGCACTGATCAAGCAGGG - Intronic
1183176899 22:36231043-36231065 AAAACTCCATTGATGAAGAAAGG + Intronic
1183181327 22:36261997-36262019 AAAACTCCATTGATGAAGAAAGG - Intronic
949221837 3:1643831-1643853 AAAAATGTACTTACCAAGCATGG - Intergenic
949270077 3:2205286-2205308 AAAAATACAGTGATAATGCAGGG + Intronic
949319771 3:2796231-2796253 AGAACTGCAATGATGAAGGAAGG - Intronic
949368666 3:3310743-3310765 AAGAATGAACTGCTGAAGGAGGG + Intergenic
950891719 3:16410066-16410088 AAAAAGGCACTGATGAAAAATGG + Intronic
952171598 3:30812990-30813012 GAAAATGCAGTGAGGAAGCCTGG + Intronic
952228382 3:31402912-31402934 TAAAAAGCATTAATGAAGCAGGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953711569 3:45275566-45275588 AAAGATGCAATGCTGAAGCAGGG + Intergenic
956933023 3:74067589-74067611 CAAAATGCCCTGATGAAGCCAGG - Intergenic
958027703 3:88068202-88068224 AAATAAGCACTGATGAACAAAGG - Intronic
958033137 3:88138042-88138064 AAACATTCACTGATGACTCAAGG - Intronic
958717584 3:97804189-97804211 AAATCTGCACTGATGCAGCCAGG + Intergenic
959127395 3:102307098-102307120 AAAAATGCACTGAAGAAGGTAGG + Intronic
959577338 3:107948516-107948538 AAAAGTTCTCTGATGATGCAGGG - Intergenic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG + Intergenic
963911930 3:150822336-150822358 AAAAAATCACTGATGTGGCATGG - Intergenic
965902180 3:173655882-173655904 CAAAATGCACAGACAAAGCAAGG + Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
966374326 3:179280119-179280141 AAAGATCCACTGATTAAGCTGGG + Intergenic
967228484 3:187315519-187315541 AACAATACACTTACGAAGCATGG + Intergenic
967732608 3:192919650-192919672 CAAAAAGCAATGATGAAGCAAGG - Intergenic
968333265 3:197890097-197890119 AAAAATGCACAGATAATGCCAGG + Intronic
969129202 4:4978968-4978990 ATAAATGAAGTGATGGAGCAAGG - Intergenic
969547387 4:7840179-7840201 AAACATTCACTGATGTAGGAAGG + Intronic
970441721 4:16085809-16085831 AAAGAGGCACTGAAGAAGCCAGG + Intergenic
971829749 4:31675451-31675473 AAAAATACACTAATTGAGCAAGG - Intergenic
972116528 4:35642551-35642573 CAAAATGCACAAATAAAGCAAGG + Intergenic
972303148 4:37805189-37805211 AAAACTGCACTGAAGACACAAGG - Intergenic
973131917 4:46658417-46658439 CAGTATGCAATGATGAAGCATGG + Intergenic
975148119 4:70992717-70992739 AAAAATGCACTCATCTAGCTGGG + Intronic
976247570 4:83019052-83019074 AAAAATGAACTCATGAACAAAGG - Intergenic
976254541 4:83086298-83086320 AAAAATGGACTGAGGAGGCCGGG + Intergenic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
976604162 4:86967074-86967096 AGGGATGGACTGATGAAGCAGGG - Intronic
976740585 4:88352515-88352537 AAATCTGCATTGATGAAGCCAGG - Intergenic
977307318 4:95341741-95341763 AAAAATGCACTGAAGAATGTAGG + Intronic
979715772 4:123835480-123835502 TAAAATGCAATGATAAAGTAGGG - Intergenic
980689612 4:136278456-136278478 AAAAATGCACTTTGGAGGCATGG + Intergenic
980941384 4:139278743-139278765 ATATATACACTGATGAAGTAGGG - Intronic
981235328 4:142408775-142408797 AAAAATCTACTGATGAATGAAGG - Intronic
981696633 4:147565300-147565322 CAAAACGCACAAATGAAGCATGG + Intergenic
982108630 4:152033179-152033201 CTAAATGCAATGAGGAAGCATGG + Intergenic
982451461 4:155557269-155557291 AAAAATCAACTCATGATGCATGG + Intergenic
984718564 4:182949178-182949200 AAAAATGGAATTGTGAAGCAAGG + Intergenic
986383978 5:7213208-7213230 AAAATGGCACTTAGGAAGCAAGG - Intergenic
986527258 5:8693507-8693529 AAAAATGTGCTGAGGCAGCAAGG + Intergenic
987550070 5:19368090-19368112 AAAAATGCAAGGATGAAGAAGGG + Intergenic
987769982 5:22289652-22289674 AAATATGCATTGAAGAAGGAAGG + Intronic
988550473 5:32196559-32196581 AAAAATGCAAAGATGAGCCAGGG - Intergenic
989564446 5:42887919-42887941 AAAAATGCACTGATTCAGGCAGG - Intergenic
990047262 5:51448350-51448372 AAAAATGAACAGATGAACCTTGG - Intergenic
990770994 5:59245060-59245082 AGAAATGCATTTATGATGCAAGG + Intronic
991981693 5:72238366-72238388 TAAAATGAACTGTTGAAGTAAGG - Intronic
992067730 5:73122956-73122978 AAAAAAGCACTGGTGAATGAGGG - Intronic
992068536 5:73129094-73129116 CAAAATGCACAAACGAAGCAAGG + Intronic
994166505 5:96614720-96614742 AAAAAAGCACTGAGGAAGAGGGG - Intronic
994226037 5:97253072-97253094 AAAGATGCACTGAAGAAGGTAGG + Intergenic
994862092 5:105209834-105209856 AAAAAAACACAGCTGAAGCATGG - Intergenic
995128784 5:108608058-108608080 AAAAATGCACTGATAACCTAGGG + Intergenic
995282992 5:110356216-110356238 AAAAATGCAGTGATTTAACATGG - Intronic
996933353 5:128917928-128917950 ACAGATGCACAGAAGAAGCAAGG - Intronic
998598721 5:143562279-143562301 ATAAATGAACTGATAAAACATGG + Intergenic
999189542 5:149736732-149736754 AAAAATGTACTGAGGAGCCATGG - Intronic
999651755 5:153774892-153774914 ACAAATACTCTGATGAAGCAAGG + Intronic
1001671036 5:173474206-173474228 ATAAATGCCCTGAAGAAGAACGG + Intergenic
1001776706 5:174334310-174334332 ACTAATGCACTGATGAGGCTGGG - Intergenic
1005276713 6:24227404-24227426 AACAAACCACTGAAGAAGCAGGG + Intronic
1007273372 6:40655618-40655640 AAAGATGCTCAGCTGAAGCAGGG + Intergenic
1007818032 6:44538622-44538644 AAAAATTCAGTGTTGAATCATGG - Intergenic
1010251850 6:73715270-73715292 AAAAAACCAGTGATGAGGCACGG + Intronic
1010692416 6:78925975-78925997 AAATAAGCACTGATTAAACATGG + Intronic
1010917793 6:81641999-81642021 AAGAATGAACTGAAGAAGGAAGG + Intronic
1011486439 6:87846722-87846744 AAAAATGCATTGAGAGAGCAGGG + Intergenic
1012190659 6:96276272-96276294 AAAAATGCACTAAAGAAGGTAGG + Intergenic
1012482966 6:99688995-99689017 AAAAAGGCACTGAAGAAGGTAGG + Intergenic
1012563738 6:100619596-100619618 AAAAATGTACAGATGATGTATGG + Intronic
1013486776 6:110604247-110604269 AAAAATGGACTAATGCAGAAAGG + Intergenic
1014537677 6:122634709-122634731 AAAAATGCTCTGATGAGCCATGG - Intronic
1015014203 6:128390603-128390625 TCAACTGCAGTGATGAAGCACGG + Intronic
1016016667 6:139193490-139193512 AAAGATCCACTTATGAAACAGGG - Intergenic
1016253561 6:142076460-142076482 AAAACTGATCTGATGAAGCAGGG + Intronic
1016959869 6:149663008-149663030 TAAAATGAAATGATGAAGAAAGG + Intronic
1017041599 6:150312838-150312860 CAAAATGCACAAATAAAGCAAGG - Intergenic
1019234282 6:170596801-170596823 GAAAATGCTCTGCTGAACCATGG - Intergenic
1022012064 7:26316776-26316798 GGCACTGCACTGATGAAGCATGG - Intronic
1023687019 7:42746391-42746413 AAAAAGGCACTTATGAGTCATGG + Intergenic
1024191873 7:47020394-47020416 AAAAATGCACAAACAAAGCAAGG + Intergenic
1024847055 7:53658186-53658208 AAATATGAAATGATGAAGCTAGG - Intergenic
1025242122 7:57285815-57285837 AAAATTCCACTGATGAAGCCAGG - Intergenic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1027737016 7:81945354-81945376 AAAGAAGAACTGATGAAGCAAGG + Intergenic
1027744138 7:82052243-82052265 AATAAGGCACTGAGGAAGGAGGG - Intronic
1028127468 7:87130215-87130237 ATAAATGAACTGAAGAAGAAGGG + Intergenic
1028291625 7:89072792-89072814 AAAAATGCAATGAAGAAATAAGG + Intronic
1028495975 7:91461763-91461785 AAAAATGCCCTGGTAAAGGATGG - Intergenic
1028759981 7:94485099-94485121 AAAAATGCACTAATAAAAAAAGG + Intergenic
1029636710 7:101789441-101789463 AAAAGCCCACTGAAGAAGCATGG + Intergenic
1030495161 7:110289612-110289634 ACAAATGCACTTAGGAAGCTAGG - Intergenic
1030842625 7:114374954-114374976 AAAAATGAACTGGAGAAACAAGG + Intronic
1031590143 7:123580862-123580884 AAAAACGCAGTGTTGAAGCTTGG + Intronic
1031599942 7:123694714-123694736 AAAAATGAACTGCGGAGGCAAGG - Exonic
1031985253 7:128160296-128160318 ATAAATGCAGGGGTGAAGCAAGG + Intergenic
1032613218 7:133439166-133439188 AAAAAAGAACTGATGAAATATGG - Intronic
1035378636 7:158424279-158424301 AGAAAAGCAATAATGAAGCAAGG + Intronic
1035432265 7:158830740-158830762 ACAAATGCCCAGAAGAAGCAGGG + Intergenic
1038099832 8:24361099-24361121 AATAATGCAGTGATGAACAATGG + Intergenic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1041991169 8:63993499-63993521 AGAGCTGCACTGATGAAGCAGGG - Intergenic
1042374823 8:68038414-68038436 AGAAATGCACTGATGGATGATGG - Intronic
1042600498 8:70494714-70494736 GAAAAATCACTGATGGAGCATGG - Intergenic
1044121415 8:88401154-88401176 GAAACTGCACTGAAGAAGCCTGG - Intergenic
1045006700 8:97922325-97922347 AAAACTGCACTCATGAGGGAGGG - Intronic
1045604562 8:103757735-103757757 ACATATGCACTGATGATACAAGG - Intronic
1046239563 8:111473181-111473203 AAGAATTCAGTGAAGAAGCACGG + Intergenic
1048151087 8:131895149-131895171 AAACATGCACTGAGGTAACAGGG - Intergenic
1048171540 8:132111368-132111390 GACAATGCACTGATTCAGCATGG + Intergenic
1049248144 8:141573774-141573796 CAAAATGCACAAATAAAGCAAGG - Intergenic
1050621055 9:7452353-7452375 AAAAAGGGATTTATGAAGCAAGG + Intergenic
1050893812 9:10859151-10859173 AATGATGCACTGATTAAGGAAGG + Intergenic
1051073952 9:13207652-13207674 AAAAATGCTATGAGGAAGAATGG - Intronic
1051455202 9:17247544-17247566 AAAGAGGCACTGAAGAAGGAAGG - Intronic
1052157551 9:25212967-25212989 AAGAATGCTCTGTTGATGCAAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054957693 9:70932187-70932209 AATAATGTAATGATAAAGCAAGG - Intronic
1055838047 9:80468258-80468280 AATAATTGACTGATGAAGAAGGG + Intergenic
1056101814 9:83307101-83307123 AAAAATGGAGTGAAGAAACAAGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056599230 9:88033220-88033242 ATAAATGCACTTATGAACCTGGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058010416 9:99970717-99970739 TAATATGCAGTGATGAAGAAGGG - Intergenic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1062512610 9:136915479-136915501 AAAAATGCACTGAACACGCGCGG + Intronic
1203523109 Un_GL000213v1:62589-62611 AAAAGTGCAAGGATGAAGAAGGG + Intergenic
1185710889 X:2302837-2302859 AAAAATGCATTTAAGAAACATGG - Intronic
1186830295 X:13383469-13383491 AAATCTGCACTGATGCAGCCAGG - Intergenic
1188145747 X:26610844-26610866 AAAAATGTTCTGATGAAGACTGG - Intergenic
1188858465 X:35226423-35226445 AAAAAGGCATTTATGAAACAAGG + Intergenic
1189414810 X:40804383-40804405 CAACATGCACCCATGAAGCAGGG + Intergenic
1192067869 X:67904857-67904879 AAAGATTCATGGATGAAGCATGG + Intergenic
1193588498 X:83357793-83357815 AAAAATGAACTGAGAAACCAAGG + Intergenic
1194055734 X:89128747-89128769 AAAAATCCATGGGTGAAGCATGG + Intergenic
1194600721 X:95918545-95918567 AAATATGCAATGATCAAGGAAGG - Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1195346160 X:103953175-103953197 AAAAATCCATGGAAGAAGCATGG - Intronic
1195587980 X:106587766-106587788 CAATATGCAATGATGAAACAAGG + Intergenic
1195807977 X:108796726-108796748 AAAAATCCTTTGAAGAAGCAAGG - Intergenic
1195840380 X:109169951-109169973 AGAAATGCACTTGAGAAGCAAGG - Intergenic
1195869905 X:109475029-109475051 AAATAGGCTCTGTTGAAGCAGGG + Intronic
1196339208 X:114577536-114577558 AGAAAAGCACTGATAAATCAGGG - Intergenic
1197181292 X:123539523-123539545 AAAGATGCACTGGTGAAGGTAGG - Intergenic
1197406154 X:126053717-126053739 AAACATGCAGGGATGAGGCAAGG + Intergenic
1198516856 X:137417592-137417614 AAAAATGTAATGATGTAGCCAGG + Intergenic
1198747004 X:139901185-139901207 AAGAATGCCCAAATGAAGCATGG + Intronic
1198761515 X:140037987-140038009 AAAAAAGCACTGATAATCCATGG + Intergenic
1199790191 X:151146668-151146690 ACAAATGCAATGTTGAAGAAAGG - Intergenic
1199839470 X:151629921-151629943 AAAAATATTCTGATGCAGCAAGG + Intronic
1200800071 Y:7378397-7378419 AAAAGGTCACTGATGAAACAGGG - Intergenic
1201330867 Y:12819395-12819417 AAAAATGCAAAAATTAAGCATGG + Intronic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201954101 Y:19602112-19602134 AAGAATGCAGTGATGGAGGAAGG + Intergenic
1202044513 Y:20725110-20725132 TAAAATGCACAAACGAAGCAAGG + Intergenic
1202174232 Y:22083043-22083065 AAAAATACAGAGATGAGGCAAGG - Intronic
1202217128 Y:22503339-22503361 AAAAATACAGAGATGAGGCAAGG + Intronic
1202326057 Y:23692731-23692753 AAAAATACAGAGATGAGGCAAGG - Intergenic
1202544714 Y:25977323-25977345 AAAAATACAGAGATGAGGCAAGG + Intergenic