ID: 1129029337

View in Genome Browser
Species Human (GRCh38)
Location 15:72607297-72607319
Sequence TTAGGGTAGCAGATGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129029337_1129029349 26 Left 1129029337 15:72607297-72607319 CCCTGCATCATCTGCTACCCTAA No data
Right 1129029349 15:72607346-72607368 CTGAGGTGCAGTGACCCTGCAGG No data
1129029337_1129029344 -4 Left 1129029337 15:72607297-72607319 CCCTGCATCATCTGCTACCCTAA No data
Right 1129029344 15:72607316-72607338 CTAAAGGATCTGGAGGTAAGAGG No data
1129029337_1129029346 9 Left 1129029337 15:72607297-72607319 CCCTGCATCATCTGCTACCCTAA No data
Right 1129029346 15:72607329-72607351 AGGTAAGAGGCCCTAGGCTGAGG No data
1129029337_1129029345 3 Left 1129029337 15:72607297-72607319 CCCTGCATCATCTGCTACCCTAA No data
Right 1129029345 15:72607323-72607345 ATCTGGAGGTAAGAGGCCCTAGG 0: 18
1: 24
2: 5
3: 22
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129029337 Original CRISPR TTAGGGTAGCAGATGATGCA GGG (reversed) Intergenic
No off target data available for this crispr