ID: 1129030268

View in Genome Browser
Species Human (GRCh38)
Location 15:72612529-72612551
Sequence GGGCATACACAGAACAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129030268_1129030279 18 Left 1129030268 15:72612529-72612551 CCCTGTTTGTTCTGTGTATGCCC No data
Right 1129030279 15:72612570-72612592 GGTGGCCAGGCCATGCAGCCAGG No data
1129030268_1129030272 -4 Left 1129030268 15:72612529-72612551 CCCTGTTTGTTCTGTGTATGCCC No data
Right 1129030272 15:72612548-72612570 GCCCCTACAAGAAGGGCATCAGG No data
1129030268_1129030277 0 Left 1129030268 15:72612529-72612551 CCCTGTTTGTTCTGTGTATGCCC No data
Right 1129030277 15:72612552-72612574 CTACAAGAAGGGCATCAGGGTGG No data
1129030268_1129030278 5 Left 1129030268 15:72612529-72612551 CCCTGTTTGTTCTGTGTATGCCC No data
Right 1129030278 15:72612557-72612579 AGAAGGGCATCAGGGTGGCCAGG No data
1129030268_1129030274 -3 Left 1129030268 15:72612529-72612551 CCCTGTTTGTTCTGTGTATGCCC No data
Right 1129030274 15:72612549-72612571 CCCCTACAAGAAGGGCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129030268 Original CRISPR GGGCATACACAGAACAAACA GGG (reversed) Intergenic
No off target data available for this crispr