ID: 1129030751

View in Genome Browser
Species Human (GRCh38)
Location 15:72616017-72616039
Sequence AGGGAGAATGCAGCAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129030751_1129030767 29 Left 1129030751 15:72616017-72616039 CCCACAGTTGCTGCATTCTCCCT No data
Right 1129030767 15:72616069-72616091 AGCGACCACTGCTGGGGGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 262
1129030751_1129030768 30 Left 1129030751 15:72616017-72616039 CCCACAGTTGCTGCATTCTCCCT No data
Right 1129030768 15:72616070-72616092 GCGACCACTGCTGGGGGAGGGGG 0: 1
1: 1
2: 2
3: 46
4: 404
1129030751_1129030762 23 Left 1129030751 15:72616017-72616039 CCCACAGTTGCTGCATTCTCCCT No data
Right 1129030762 15:72616063-72616085 CACCACAGCGACCACTGCTGGGG 0: 1
1: 2
2: 2
3: 27
4: 185
1129030751_1129030765 27 Left 1129030751 15:72616017-72616039 CCCACAGTTGCTGCATTCTCCCT No data
Right 1129030765 15:72616067-72616089 ACAGCGACCACTGCTGGGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 178
1129030751_1129030763 24 Left 1129030751 15:72616017-72616039 CCCACAGTTGCTGCATTCTCCCT No data
Right 1129030763 15:72616064-72616086 ACCACAGCGACCACTGCTGGGGG 0: 1
1: 1
2: 2
3: 13
4: 174
1129030751_1129030760 21 Left 1129030751 15:72616017-72616039 CCCACAGTTGCTGCATTCTCCCT No data
Right 1129030760 15:72616061-72616083 AGCACCACAGCGACCACTGCTGG 0: 1
1: 1
2: 3
3: 17
4: 170
1129030751_1129030761 22 Left 1129030751 15:72616017-72616039 CCCACAGTTGCTGCATTCTCCCT No data
Right 1129030761 15:72616062-72616084 GCACCACAGCGACCACTGCTGGG 0: 1
1: 1
2: 2
3: 21
4: 189
1129030751_1129030766 28 Left 1129030751 15:72616017-72616039 CCCACAGTTGCTGCATTCTCCCT No data
Right 1129030766 15:72616068-72616090 CAGCGACCACTGCTGGGGGAGGG 0: 1
1: 1
2: 3
3: 27
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129030751 Original CRISPR AGGGAGAATGCAGCAACTGT GGG (reversed) Intergenic
No off target data available for this crispr