ID: 1129032521

View in Genome Browser
Species Human (GRCh38)
Location 15:72629303-72629325
Sequence CCTCACAGGCAGAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129032521_1129032537 13 Left 1129032521 15:72629303-72629325 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129032537 15:72629339-72629361 AAGGAGGGGCATTCACCTGTAGG No data
1129032521_1129032533 -3 Left 1129032521 15:72629303-72629325 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129032533 15:72629323-72629345 AGGTGGGTGGGGCCGGAAGGAGG No data
1129032521_1129032530 -10 Left 1129032521 15:72629303-72629325 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129032530 15:72629316-72629338 GCCTGTGAGGTGGGTGGGGCCGG No data
1129032521_1129032532 -6 Left 1129032521 15:72629303-72629325 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129032532 15:72629320-72629342 GTGAGGTGGGTGGGGCCGGAAGG No data
1129032521_1129032535 -1 Left 1129032521 15:72629303-72629325 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129032535 15:72629325-72629347 GTGGGTGGGGCCGGAAGGAGGGG No data
1129032521_1129032534 -2 Left 1129032521 15:72629303-72629325 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129032534 15:72629324-72629346 GGTGGGTGGGGCCGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129032521 Original CRISPR CCTCACAGGCAGAAAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr