ID: 1129032530

View in Genome Browser
Species Human (GRCh38)
Location 15:72629316-72629338
Sequence GCCTGTGAGGTGGGTGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129032518_1129032530 9 Left 1129032518 15:72629284-72629306 CCTCAACCTCCTTGTGAAGCCTC No data
Right 1129032530 15:72629316-72629338 GCCTGTGAGGTGGGTGGGGCCGG No data
1129032515_1129032530 27 Left 1129032515 15:72629266-72629288 CCCGGGCTCTCCTGTTTACCTCA No data
Right 1129032530 15:72629316-72629338 GCCTGTGAGGTGGGTGGGGCCGG No data
1129032521_1129032530 -10 Left 1129032521 15:72629303-72629325 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129032530 15:72629316-72629338 GCCTGTGAGGTGGGTGGGGCCGG No data
1129032517_1129032530 17 Left 1129032517 15:72629276-72629298 CCTGTTTACCTCAACCTCCTTGT No data
Right 1129032530 15:72629316-72629338 GCCTGTGAGGTGGGTGGGGCCGG No data
1129032516_1129032530 26 Left 1129032516 15:72629267-72629289 CCGGGCTCTCCTGTTTACCTCAA No data
Right 1129032530 15:72629316-72629338 GCCTGTGAGGTGGGTGGGGCCGG No data
1129032520_1129032530 0 Left 1129032520 15:72629293-72629315 CCTTGTGAAGCCTCCCTCTTTCT No data
Right 1129032530 15:72629316-72629338 GCCTGTGAGGTGGGTGGGGCCGG No data
1129032519_1129032530 3 Left 1129032519 15:72629290-72629312 CCTCCTTGTGAAGCCTCCCTCTT No data
Right 1129032530 15:72629316-72629338 GCCTGTGAGGTGGGTGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129032530 Original CRISPR GCCTGTGAGGTGGGTGGGGC CGG Intergenic
No off target data available for this crispr