ID: 1129032534

View in Genome Browser
Species Human (GRCh38)
Location 15:72629324-72629346
Sequence GGTGGGTGGGGCCGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129032521_1129032534 -2 Left 1129032521 15:72629303-72629325 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129032534 15:72629324-72629346 GGTGGGTGGGGCCGGAAGGAGGG No data
1129032520_1129032534 8 Left 1129032520 15:72629293-72629315 CCTTGTGAAGCCTCCCTCTTTCT No data
Right 1129032534 15:72629324-72629346 GGTGGGTGGGGCCGGAAGGAGGG No data
1129032525_1129032534 -6 Left 1129032525 15:72629307-72629329 CCTCTTTCTGCCTGTGAGGTGGG No data
Right 1129032534 15:72629324-72629346 GGTGGGTGGGGCCGGAAGGAGGG No data
1129032519_1129032534 11 Left 1129032519 15:72629290-72629312 CCTCCTTGTGAAGCCTCCCTCTT No data
Right 1129032534 15:72629324-72629346 GGTGGGTGGGGCCGGAAGGAGGG No data
1129032523_1129032534 -5 Left 1129032523 15:72629306-72629328 CCCTCTTTCTGCCTGTGAGGTGG No data
Right 1129032534 15:72629324-72629346 GGTGGGTGGGGCCGGAAGGAGGG No data
1129032518_1129032534 17 Left 1129032518 15:72629284-72629306 CCTCAACCTCCTTGTGAAGCCTC No data
Right 1129032534 15:72629324-72629346 GGTGGGTGGGGCCGGAAGGAGGG No data
1129032517_1129032534 25 Left 1129032517 15:72629276-72629298 CCTGTTTACCTCAACCTCCTTGT No data
Right 1129032534 15:72629324-72629346 GGTGGGTGGGGCCGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129032534 Original CRISPR GGTGGGTGGGGCCGGAAGGA GGG Intergenic
No off target data available for this crispr