ID: 1129032537

View in Genome Browser
Species Human (GRCh38)
Location 15:72629339-72629361
Sequence AAGGAGGGGCATTCACCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129032531_1129032537 -1 Left 1129032531 15:72629317-72629339 CCTGTGAGGTGGGTGGGGCCGGA No data
Right 1129032537 15:72629339-72629361 AAGGAGGGGCATTCACCTGTAGG No data
1129032521_1129032537 13 Left 1129032521 15:72629303-72629325 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129032537 15:72629339-72629361 AAGGAGGGGCATTCACCTGTAGG No data
1129032520_1129032537 23 Left 1129032520 15:72629293-72629315 CCTTGTGAAGCCTCCCTCTTTCT No data
Right 1129032537 15:72629339-72629361 AAGGAGGGGCATTCACCTGTAGG No data
1129032525_1129032537 9 Left 1129032525 15:72629307-72629329 CCTCTTTCTGCCTGTGAGGTGGG No data
Right 1129032537 15:72629339-72629361 AAGGAGGGGCATTCACCTGTAGG No data
1129032519_1129032537 26 Left 1129032519 15:72629290-72629312 CCTCCTTGTGAAGCCTCCCTCTT No data
Right 1129032537 15:72629339-72629361 AAGGAGGGGCATTCACCTGTAGG No data
1129032523_1129032537 10 Left 1129032523 15:72629306-72629328 CCCTCTTTCTGCCTGTGAGGTGG No data
Right 1129032537 15:72629339-72629361 AAGGAGGGGCATTCACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129032537 Original CRISPR AAGGAGGGGCATTCACCTGT AGG Intergenic
No off target data available for this crispr