ID: 1129040066

View in Genome Browser
Species Human (GRCh38)
Location 15:72678266-72678288
Sequence AAGCTGTTCTAGTGGATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129040066_1129040070 10 Left 1129040066 15:72678266-72678288 CCTGGGATCCACTAGAACAGCTT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1129040070 15:72678299-72678321 CTTTTCTTTTTTTTTTAGACAGG 0: 2
1: 161
2: 2522
3: 20892
4: 36200
1129040066_1129040071 30 Left 1129040066 15:72678266-72678288 CCTGGGATCCACTAGAACAGCTT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1129040071 15:72678319-72678341 AGGTTCTCACTCTGTCACCCAGG 0: 239
1: 8339
2: 29843
3: 74062
4: 133943

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129040066 Original CRISPR AAGCTGTTCTAGTGGATCCC AGG (reversed) Intronic
900921302 1:5672502-5672524 AAGCAATTCTCCTGGATCCCTGG + Intergenic
901291010 1:8124334-8124356 AAGCTGTCCTTGTTCATCCCTGG - Intergenic
901383653 1:8892299-8892321 AAGCTGTTCTTGTTCATTCCTGG + Intergenic
901412963 1:9097824-9097846 AAGCTGTTCTTGTTCATTCCTGG + Intergenic
902970906 1:20048652-20048674 AAGCTGTTCTTGTTCATACCTGG - Intronic
903312832 1:22473292-22473314 AAACTGTTCTAGTGGATAAAGGG + Intronic
903662195 1:24984942-24984964 CAGCTGTCCTGGTGGATTCCAGG + Intergenic
907133634 1:52119149-52119171 AAGCTGTCCTAGTTCATTCCTGG + Intergenic
907495022 1:54837837-54837859 AATCTGTTCTCCTGGCTCCCAGG - Intronic
908039306 1:60090849-60090871 CAGCTGTTCACATGGATCCCAGG - Intergenic
908078597 1:60548706-60548728 AGGCTGGTCTAGTGCATCCTAGG + Intergenic
910216169 1:84847324-84847346 GGGCTGTACTAGTGGATCACTGG + Intronic
911747081 1:101451966-101451988 AAGCTGTCCTTGTTCATCCCTGG - Intergenic
911798453 1:102103842-102103864 AAGCTGTTCTTGTTCATTCCTGG - Intergenic
916175410 1:162033923-162033945 AAGCTGTTCCAGTGAATCTTGGG + Intergenic
918348157 1:183624887-183624909 AAGCATTTCCTGTGGATCCCAGG - Intronic
924320365 1:242842587-242842609 GAGCTGTTCTAGTGGCACCTTGG + Intergenic
1064842222 10:19606405-19606427 AAGCTGTTCTTGTTGAACCTGGG + Intronic
1064842332 10:19607784-19607806 AAGCTGTTCTAATGGAGCTCTGG + Exonic
1065267334 10:23991225-23991247 AAGCTGTTCAAGTGGCTGCATGG - Intronic
1068311498 10:55282894-55282916 AAGCTGTTCTTGTTCATTCCTGG + Intronic
1069969332 10:72152384-72152406 ATGCAGTTGTAGTGGATACCAGG - Intronic
1077927220 11:6693781-6693803 AAGCTGTTCTTGTTCATTCCTGG + Intergenic
1081075801 11:38672288-38672310 AAGCTGTCCTAGTTCATTCCTGG + Intergenic
1083504421 11:63142428-63142450 AAGCTGTCCTTGTGCATTCCTGG + Intronic
1086125943 11:83348558-83348580 AAGCTCTCCTTGTTGATCCCTGG - Intergenic
1087049900 11:93875931-93875953 AAGCTGTTCTTGTTCATTCCTGG + Intergenic
1092477638 12:8832516-8832538 AAGCTGTCCTTGTGGATTCCTGG - Intronic
1093101875 12:15037848-15037870 AAGCTGTCCTTGTTGATTCCCGG - Intergenic
1093616773 12:21234567-21234589 AAGCTGTTCTTGTTGATTTCTGG - Intronic
1094430824 12:30367510-30367532 CAGATACTCTAGTGGATCCCTGG + Intergenic
1096321759 12:50620325-50620347 AAGCTGTTTTCATTGATCCCAGG + Intronic
1097682524 12:62662070-62662092 CAGCAGTTCTCGTGGACCCCAGG + Intronic
1098315534 12:69188675-69188697 AAGCTGTTCTTGTTCATTCCTGG - Intergenic
1098541113 12:71658788-71658810 AAACTGTTCTAGTAAATCTCTGG + Intronic
1099033964 12:77562448-77562470 AAGCTGTTCTAGCAGACCCAGGG - Intergenic
1102517766 12:113461877-113461899 GAGCTCTTCTAGTGACTCCCAGG - Intergenic
1106460013 13:29960360-29960382 AAGCTGTTCTTGTTCATTCCTGG - Intergenic
1107728878 13:43328222-43328244 AACCTGTTCCAGTGGATCACCGG + Intronic
1109821543 13:67663336-67663358 AAGCATTTCTAGTGGACCCGAGG + Intergenic
1113363534 13:109653917-109653939 AAGCTGTTATCCTGGATCTCTGG + Intergenic
1115349083 14:32373698-32373720 AAGCTGTCCTTGTTGATTCCTGG - Intronic
1118088203 14:62442732-62442754 AAGCTGTCCTTGTGCATTCCTGG + Intergenic
1118822763 14:69355766-69355788 GAGCTGTTCCTGAGGATCCCTGG + Exonic
1120209056 14:81616463-81616485 AAGCTGTTCTTGTTCATTCCTGG + Intergenic
1121514157 14:94538182-94538204 AAGCTCTTCTAATGGTTGCCTGG - Intergenic
1122542996 14:102508242-102508264 AAGCTCTTCCAGTGGGTCCCTGG - Intronic
1125631406 15:41150582-41150604 AAGCTGTCCTAGTTCATTCCTGG + Intergenic
1128706660 15:69841862-69841884 AAGCTTTTCTTGTTGAGCCCTGG + Intergenic
1129040066 15:72678266-72678288 AAGCTGTTCTAGTGGATCCCAGG - Intronic
1132275950 15:100564089-100564111 AAGCTGTCCTTGTTCATCCCTGG + Intronic
1134392611 16:13833377-13833399 AAGCTGTCCTTGTTCATCCCTGG + Intergenic
1137643948 16:50058439-50058461 AAGGTGGTCTTGTGGATGCCGGG + Intergenic
1140458914 16:75122803-75122825 AAGCTGTTCTTGTTCATTCCTGG - Intergenic
1140508303 16:75488568-75488590 AAACTGCTCTAGTGGAGCCCTGG + Intronic
1141375124 16:83523491-83523513 AGGCTGCTCCAGTGGATTCCAGG - Intronic
1147664704 17:42139161-42139183 AAGCTGTGCTAGCAGATCCATGG - Intronic
1152114068 17:78374075-78374097 AAGCAGTCCTTGTGGATTCCTGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1160505306 18:79423448-79423470 AGGCTGGGCAAGTGGATCCCGGG - Intronic
1161050746 19:2162994-2163016 AAGCTGTCCTTGTTCATCCCTGG + Intronic
1164763172 19:30743423-30743445 AAGCAGTTCATGGGGATCCCTGG + Intergenic
1165326989 19:35119572-35119594 CAGCTCTTCTCGTGTATCCCCGG - Intronic
1166010896 19:39941935-39941957 AAGCTGTTCCTGTGGCTTCCTGG + Intergenic
926463136 2:13158502-13158524 AAGCTGTTCATGTGGATAGCTGG + Intergenic
926861756 2:17317411-17317433 AAGCTGGCCTAGTGGGTCCCAGG + Intergenic
927018379 2:18991987-18992009 AAGCTGTTCCACTGGGTCCTGGG - Intergenic
929657049 2:43744323-43744345 AAGCTATTTTATTGTATCCCAGG + Intronic
934091575 2:88555145-88555167 CAGCTGTTCTGGTGCATGCCTGG - Intergenic
940622898 2:156135123-156135145 AAGCTGGCCAAGTGGCTCCCAGG - Intergenic
944321765 2:198353558-198353580 AAAATGTTTTACTGGATCCCTGG - Intronic
944448698 2:199819090-199819112 AATCAGTTCTAGAGGAACCCTGG - Exonic
945936650 2:215909259-215909281 AAGCTGTTCTTGTTCATTCCTGG + Intergenic
946830155 2:223720460-223720482 AAGCTGTTCTTGTTCATTCCTGG - Intergenic
1171506551 20:25640521-25640543 AAGCTGTTCTTGTTCATTCCTGG + Intergenic
1171773395 20:29344694-29344716 AAGCATTTCTCCTGGATCCCTGG - Intergenic
1174277834 20:49416715-49416737 AGGCTGCTCAAGTGGAACCCAGG - Intronic
1177530475 21:22352247-22352269 AAGCTGTTCTTGTTCATTCCTGG - Intergenic
1178403095 21:32304057-32304079 AAGCTGTTCCCTTAGATCCCTGG + Intronic
1178836385 21:36100986-36101008 AAGCTGTTCTTGCCCATCCCTGG - Intergenic
1179649536 21:42798507-42798529 TACCTGGTCTACTGGATCCCAGG - Intergenic
1180318877 22:11302822-11302844 AAGCATTTCTCCTGGATCCCTGG - Intergenic
1182029964 22:27150949-27150971 AAGCTGATCTACTGGAGACCAGG - Intergenic
950921043 3:16695259-16695281 AAGCTGTTCTTGTTCATTCCTGG + Intergenic
954592720 3:51797373-51797395 AAGCTGTTCTTGTTCATTCCTGG - Intergenic
957825274 3:85433918-85433940 AAGATATTCTTTTGGATCCCTGG + Intronic
958954075 3:100448218-100448240 AAGCTGTTCTTGTTTATTCCTGG + Intronic
959161924 3:102734442-102734464 AAGCTGTTCTTGTTTATTCCTGG + Intergenic
959867219 3:111284521-111284543 AAGCTGTTCTAGTGAGTCTAGGG + Intergenic
963224710 3:142850671-142850693 AAGCTGTTCTGGTGGCACCATGG + Intronic
963993062 3:151676043-151676065 AAGCTGTCCTAGTTCATTCCTGG + Intergenic
964357236 3:155862022-155862044 AAGCTGTCCTAGTTCATTCCTGG + Intergenic
967542249 3:190681008-190681030 AAGCTGTCCTTGCGCATCCCTGG - Intergenic
967842162 3:194014926-194014948 CAGCTGTTCTAGGGAATGCCAGG + Intergenic
969352292 4:6604681-6604703 AAGCTGTATTCGTGGATCTCGGG + Intronic
969655107 4:8492462-8492484 AAGCTGTCCTTGTTCATCCCCGG + Intronic
970998191 4:22291953-22291975 AAGTTGTCCTGGTGGCTCCCCGG + Intergenic
972195316 4:36646791-36646813 AAGCTGTTCTTGTTCATTCCTGG - Intergenic
978882183 4:113718729-113718751 AAGCTGTCCTTGTTCATCCCTGG - Intronic
979075591 4:116265527-116265549 AAACTTTGCTAGTGGATCACAGG - Intergenic
979979166 4:127233646-127233668 AAGCTGTGCTATTAGATCCAAGG - Intergenic
980430916 4:132693566-132693588 ATGTTGGTCTAGTGGATCTCTGG + Intergenic
982138042 4:152291344-152291366 AAGCTATTTTAGTGGAGTCCTGG - Intergenic
984677267 4:182564105-182564127 AATCTTTTCAAGAGGATCCCTGG + Intronic
989534771 5:42550803-42550825 CAGCTGTTCAGGTGGAGCCCAGG + Intronic
991951277 5:71948782-71948804 AAGCTGTTCTTGTTAATTCCTGG - Intergenic
994831400 5:104787459-104787481 AAGCTATTTTAGTGAAACCCAGG + Intergenic
1005661710 6:28004915-28004937 AAGCTGTTCTTGTTTATTCCTGG + Intergenic
1005912506 6:30323341-30323363 AAGCTGTTCTTGTTCATTCCTGG - Intergenic
1008131957 6:47729000-47729022 AAGGTGTTCTTGTGGATCCCAGG - Intergenic
1013532680 6:111034414-111034436 AAGCTGTCCTTGTTCATCCCTGG - Intergenic
1013757220 6:113475959-113475981 AACCTGCTTTAGTGGATCCAGGG - Intergenic
1014308470 6:119770300-119770322 AAGATGATCTAGAGGGTCCCAGG + Intergenic
1019718499 7:2554372-2554394 GTGCTGTTCTGGTAGATCCCAGG - Exonic
1020090243 7:5334730-5334752 CAGGTGTTCCAGTGGATCTCTGG - Intronic
1020331192 7:7018588-7018610 AAGCTTTTCTTGTGGTTCCTAGG + Intergenic
1020403950 7:7810080-7810102 CAGTTCTTCTAGTGGATGCCAGG + Intronic
1023109881 7:36799046-36799068 AAGCAGTTCTTGTAAATCCCAGG - Intergenic
1024221201 7:47288654-47288676 AATCTGTTTTAGGGGGTCCCTGG - Intronic
1026110810 7:67457688-67457710 AAGCTGTCCTTGTTCATCCCTGG + Intergenic
1028378285 7:90170902-90170924 TTGCTTTTCTAGTTGATCCCAGG + Intronic
1028618504 7:92797980-92798002 CATCTGTTATAGTGGCTCCCAGG - Intronic
1028740484 7:94268722-94268744 AAGCTGTCCTTGTTCATCCCTGG - Intergenic
1031944137 7:127820837-127820859 TGGCTGTTGTAGTGGATCCCTGG + Intronic
1036153948 8:6324787-6324809 TAGCTGGTCTAGCGGGTCCCAGG - Intergenic
1045236449 8:100356562-100356584 AAGCTGTTCTATTTTATTCCAGG - Intronic
1045994036 8:108342392-108342414 AAGCTGTCCTTGTTTATCCCTGG + Intronic
1055991531 9:82111412-82111434 AAGCTGTTCTACTGCAGCCCAGG + Intergenic
1056638885 9:88353373-88353395 AAGCTGTCCTTGTTTATCCCTGG + Intergenic
1057467415 9:95328074-95328096 AAGCTGTTCTTGTTTATTCCTGG + Intergenic
1057724374 9:97557652-97557674 AAGATGTTCTCCTGCATCCCAGG - Intronic
1058480936 9:105394849-105394871 AAGCTGCTCTAGTGGGTGACTGG - Exonic
1061309288 9:129751904-129751926 CAGCTGTTCTACTTGATGCCCGG + Intronic
1062228681 9:135468670-135468692 AAGCTGTCCTTGTGCATTCCTGG + Intergenic
1203367097 Un_KI270442v1:268572-268594 AAGCATTTCTCCTGGATCCCTGG - Intergenic
1186027267 X:5326812-5326834 AAGCTGTTCTTGTTTATTCCTGG - Intergenic
1187521002 X:20013997-20014019 AGGCTGGTCTCCTGGATCCCAGG + Intronic
1187603291 X:20857479-20857501 AATCTGTGGGAGTGGATCCCAGG - Intergenic
1188999782 X:36931478-36931500 AAGCTGTCTTTGTGGATTCCTGG - Intergenic
1194003897 X:88466654-88466676 AAGCTGTCCTAGTTCATTCCTGG - Intergenic
1195048431 X:101076052-101076074 AAGCTGTTCTTGTTCATTCCTGG + Intergenic
1197770800 X:130087982-130088004 AAGCTGGATAAGTGGATCCCTGG + Intronic
1200135043 X:153870682-153870704 AAGCTGTTCTTGAGGAAGCCTGG + Intronic
1201071585 Y:10151654-10151676 AAGCATTTCTCCTGGATCCCTGG + Intergenic