ID: 1129043700

View in Genome Browser
Species Human (GRCh38)
Location 15:72713528-72713550
Sequence TCTTTTTTTTAGTAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 857
Summary {0: 1, 1: 1, 2: 9, 3: 91, 4: 755}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129043697_1129043700 4 Left 1129043697 15:72713501-72713523 CCTGAAGGATCTGCCTGAGGCAG 0: 1
1: 25
2: 281
3: 510
4: 706
Right 1129043700 15:72713528-72713550 TCTTTTTTTTAGTAAGTGGAAGG 0: 1
1: 1
2: 9
3: 91
4: 755
1129043695_1129043700 7 Left 1129043695 15:72713498-72713520 CCTCCTGAAGGATCTGCCTGAGG 0: 17
1: 255
2: 389
3: 420
4: 464
Right 1129043700 15:72713528-72713550 TCTTTTTTTTAGTAAGTGGAAGG 0: 1
1: 1
2: 9
3: 91
4: 755
1129043693_1129043700 19 Left 1129043693 15:72713486-72713508 CCTTCTGGAATACCTCCTGAAGG 0: 28
1: 53
2: 80
3: 80
4: 147
Right 1129043700 15:72713528-72713550 TCTTTTTTTTAGTAAGTGGAAGG 0: 1
1: 1
2: 9
3: 91
4: 755
1129043698_1129043700 -9 Left 1129043698 15:72713514-72713536 CCTGAGGCAGTTATTCTTTTTTT 0: 1
1: 0
2: 5
3: 96
4: 1092
Right 1129043700 15:72713528-72713550 TCTTTTTTTTAGTAAGTGGAAGG 0: 1
1: 1
2: 9
3: 91
4: 755

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129043700 Original CRISPR TCTTTTTTTTAGTAAGTGGA AGG Intronic
901249726 1:7768077-7768099 TCTTTGTTGGAGTGAGTGGATGG - Exonic
901723798 1:11223172-11223194 TTTTTTTTTTTTTAAGTAGAGGG + Intronic
901880341 1:12190174-12190196 TCTTTCTTTTATTAACTGGAAGG + Intronic
902201747 1:14838615-14838637 TCTTTTTGTTTGTGAGGGGAAGG + Intronic
902345326 1:15812602-15812624 TTTTTTTTTTAGTAAGAGATAGG - Intergenic
902435779 1:16397477-16397499 TCTTTTTTAAAGTAAGTTGCAGG + Exonic
902751702 1:18518071-18518093 CTTTTTTTTTAGTAAATAGAAGG + Intergenic
903107915 1:21100709-21100731 TCTTTTTTTTTGTAAGAGATGGG - Intronic
904815736 1:33196619-33196641 TTTTTCTTTTAATAAGTAGAAGG + Intergenic
906087562 1:43148827-43148849 CCTTTTTTTAAGTGTGTGGAGGG - Intronic
907488574 1:54794163-54794185 TCTCTTTTTTAGTGAGTAAAAGG + Intronic
907609858 1:55857839-55857861 TGTTTATTTTAGGGAGTGGAGGG - Intergenic
907680834 1:56561860-56561882 TTTTATTTTTAGTAAGGGCAGGG - Intronic
907716851 1:56934139-56934161 TCTTTTTTTTTTTATGTGCAGGG + Intronic
907724445 1:57005904-57005926 TATTATTATTAGTAAGTGAAAGG + Intronic
908025041 1:59941521-59941543 ACTTTTTTTCAATAAGTGGAAGG - Intergenic
908386751 1:63650167-63650189 GCTTTTGTTCAGTAAGTGGAAGG - Intronic
908444098 1:64185214-64185236 TTTTGTTTTTAATAAGTAGAAGG + Intergenic
908680565 1:66656345-66656367 ACTTGTTTTTTATAAGTGGAAGG + Intronic
908925852 1:69254088-69254110 ACTTTTTTTTAATAAGTAGAAGG - Intergenic
909625684 1:77713385-77713407 TCATTGTTTTTTTAAGTGGAAGG + Intronic
909715291 1:78700506-78700528 TTTTTTTTTTATTAAGATGATGG + Intergenic
909799805 1:79792330-79792352 TCTTTTATCTCATAAGTGGAGGG - Intergenic
910792324 1:91064307-91064329 TGTGTTTTTTGGTAAGTGGAGGG + Intergenic
910903887 1:92152663-92152685 TTTTTTTTTAAGCAAGTGGTAGG + Intergenic
911066975 1:93798442-93798464 AATTTTTTTTGGTAACTGGATGG + Intronic
911135371 1:94433656-94433678 TCTTTTTTTTAGACAGTGTCTGG + Intronic
911214955 1:95182831-95182853 TTTTTTTTTTAAGAAGTGGATGG + Intronic
911240748 1:95463100-95463122 TATTTTTTTTTGTTGGTGGAAGG + Intergenic
911321949 1:96425232-96425254 TTTTTTTTTTAGTAATTTAATGG - Intergenic
911411291 1:97510698-97510720 TCTTTTTATCAATAAGTGGATGG + Intronic
911642082 1:100300321-100300343 CCTCTTTTTTAGGAAGAGGATGG - Intergenic
912936719 1:114009802-114009824 ACTTTTTTTTAATAGGTAGAAGG - Intergenic
913581838 1:120234061-120234083 TCTGTTTTTTAGTGGGTGGGAGG + Intergenic
913626337 1:120664327-120664349 TCTGTTTTTTAGTGGGTGGGAGG - Intergenic
914563769 1:148845508-148845530 TCTGTTTTTTAGTGGGTGGGAGG + Intronic
914609058 1:149284718-149284740 TCTGTTTTTTAGTGGGTGGGAGG - Intergenic
916199086 1:162252575-162252597 TATTTTATCTCGTAAGTGGAGGG + Intronic
916393359 1:164357695-164357717 TCTTTTTTTTATTATTTGTAAGG + Intergenic
916529763 1:165645476-165645498 ATTTTTTTTTAATAAGTAGAAGG + Intronic
917245182 1:172993220-172993242 TTTGTTTTTTAGTGACTGGAGGG - Intergenic
917258251 1:173139701-173139723 TTTTTTTTTTTTTGAGTGGAGGG + Intergenic
917260540 1:173162563-173162585 ACTTTTTTTTAATAAGTAGAAGG + Intergenic
917302335 1:173589383-173589405 TCTTATTTTTAGTAAAGGCAAGG - Intronic
917463589 1:175254488-175254510 TTTTTTTTTTTTTAAGTGGAAGG + Intergenic
917545039 1:175956765-175956787 TTTTTTTGTTAATAAGTAGAAGG - Intronic
917785652 1:178454342-178454364 ACTTTTTTTTATTTTGTGGAGGG - Intronic
918314587 1:183312557-183312579 TTTTTTTTTTAGGAACTGTAAGG - Intronic
918518994 1:185394170-185394192 TCTTTTTTTTTGTATTTAGATGG + Intergenic
918811781 1:189132142-189132164 TCTTTTTTTTAATGAGTATAGGG + Intergenic
918904946 1:190479029-190479051 TCTCTTTTTTAGAAATAGGAGGG + Intergenic
918916398 1:190645413-190645435 TTTTTTTTTTTGTAAGTAGAAGG + Intergenic
918924251 1:190760369-190760391 TCTTTTAGTGAGTAAGTGGCAGG + Intergenic
919234439 1:194821384-194821406 TATTTTTTTAATTAAGTGCAAGG + Intergenic
919258823 1:195162642-195162664 TTTTTTTTTTAGTGGGGGGAGGG + Intergenic
919445883 1:197704543-197704565 TCTTTTTTTGATACAGTGGAGGG - Intronic
919898426 1:202024725-202024747 CCTTTTTTTTTTTAAGTGAAAGG - Intergenic
920068423 1:203285578-203285600 TCTTTTTTTTTTTAAGAGAAGGG - Intergenic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
920530124 1:206695771-206695793 TCTTTTTTTTTTTAACAGGAAGG + Intronic
920680231 1:208066652-208066674 GCTTTTTTTAAATAAGTAGAAGG - Intronic
920835958 1:209511153-209511175 TCTTTTTATTTTTGAGTGGATGG - Intergenic
921141544 1:212311584-212311606 TTTTTTTTGTAATAAGTAGAAGG - Intronic
921394075 1:214650265-214650287 TATTTTTTTTAGAAATTGAAAGG + Intronic
921503970 1:215943519-215943541 TCTCTTTTTTTGTAAATGAAAGG + Intronic
922125221 1:222714493-222714515 TTTTTTTTTTTTTAAGTAGAAGG + Intronic
923417921 1:233782864-233782886 TTTTTTTTTTAATGAGTAGAAGG + Intergenic
924675589 1:246174115-246174137 TATTTTTTTTAATAAGTAGAAGG + Intronic
924780964 1:247147123-247147145 ACTTTTATCTCGTAAGTGGAGGG + Intronic
924954000 1:248909998-248910020 TCTGTATGTTAGCAAGTGGATGG + Intronic
1063241520 10:4174572-4174594 TTTTTTTTTTAGTAGACGGAGGG - Intergenic
1063510416 10:6639322-6639344 TCTTTTTATTATTAAATTGAAGG + Intergenic
1063723707 10:8613489-8613511 TTTTTTTTTTTTTAGGTGGAGGG + Intergenic
1064089347 10:12370398-12370420 CTTTTTTTTTAATAAGTAGAAGG - Intronic
1064762287 10:18633624-18633646 TTTTTTTTTCACTAAGTGCATGG - Intronic
1065060772 10:21898824-21898846 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1065575502 10:27113816-27113838 TCATTTTTTTTTTAAGGGGATGG - Intronic
1066127062 10:32351904-32351926 TATTTTTTTTAGTAAGGACAGGG + Intronic
1067340435 10:45397375-45397397 TCTTTTTTTGTGTATGTGGGGGG - Intronic
1067457317 10:46428447-46428469 TTTTCTTTTTAATAAGTAGAAGG - Intergenic
1067629885 10:47956191-47956213 TTTTCTTTTTAATAAGTAGAAGG + Intergenic
1068112198 10:52692774-52692796 TCTTACTTTTATTTAGTGGATGG + Intergenic
1068261113 10:54583371-54583393 ATTTTATTTTACTAAGTGGAGGG + Intronic
1068372943 10:56142399-56142421 TTTTTTTTTGAGGAAGTGGTAGG + Intergenic
1068439719 10:57036029-57036051 TTTTTTATTTAATAAGTAGAAGG + Intergenic
1068482440 10:57609832-57609854 TTTTTTTTTTTGCTAGTGGAAGG - Intergenic
1068638268 10:59372058-59372080 CCTTTTTTTTAATAAGTAGAAGG + Intergenic
1068830839 10:61493280-61493302 TCCTTTTTTTAATAAGGTGAGGG + Intergenic
1069316063 10:67104114-67104136 TCTTTTTTTCAGCCAGTTGAAGG - Intronic
1069460350 10:68589341-68589363 TCTTTTACTTAATAAGTGTAAGG + Intronic
1070429477 10:76322741-76322763 TCTTTTTTTTAGCAATGAGATGG + Intronic
1070620928 10:78010283-78010305 TCTTTTTTTTTTTAATTGGTTGG - Intronic
1070869248 10:79734967-79734989 ACTTTTTTTTAATAAGTAGAAGG - Intergenic
1071339599 10:84632163-84632185 ACTTTTTTTTAATAAGTAAAAGG - Intergenic
1071636163 10:87257154-87257176 ACTTTTTTTTAATAAGTAGAAGG - Intergenic
1071659077 10:87480789-87480811 ACTTTTTTTTAATAAGTAGAAGG + Intergenic
1071953019 10:90726803-90726825 AATTTTTTTTAATAATTGGATGG - Intergenic
1073236280 10:102019385-102019407 TTTTTTTTTAAATAAGTAGAAGG - Intronic
1073498663 10:103917246-103917268 TTTTTTTTTTAGTAGGTGTTTGG - Intronic
1073974672 10:109087179-109087201 TTTTTTTTTAAGTAAGTTGCAGG + Intergenic
1074026359 10:109640079-109640101 TTTTATTTTTATTAAGGGGAAGG + Intergenic
1074204391 10:111269872-111269894 TTTTCTTTTTAGTAACTGCAGGG + Intergenic
1074342768 10:112650462-112650484 TTTTTTTTTAAATAAGTGGAAGG + Intronic
1074474575 10:113758430-113758452 TCTTTTTTTTTCTAAGTAGCAGG + Intronic
1074488645 10:113916311-113916333 TATTGTTTTTAGTAAGAGGGAGG - Exonic
1074500347 10:114017976-114017998 TCTATTCTGTAGGAAGTGGAGGG - Intergenic
1075131573 10:119744319-119744341 TCTTTGTTTTAGCAAGGGGAAGG - Intronic
1075139953 10:119823759-119823781 TATTTTTTTTAGTATGTTTATGG + Intronic
1075141244 10:119838012-119838034 TTTTTTTTTCAGTGAGTGTAAGG - Intronic
1075392412 10:122101876-122101898 TCTTTTTTTTAAAAAAAGGATGG - Intronic
1075423000 10:122317880-122317902 ACTTTTTTTTTATAAGTAGAAGG + Intronic
1076158062 10:128218757-128218779 TTTTTTTTTTAATAAGTAGAAGG - Intergenic
1076172374 10:128332030-128332052 TTTTTTTTTTAACAAATGGAAGG + Intergenic
1076787169 10:132756716-132756738 ACCTTTTTTTATTAAGTAGAAGG - Intronic
1078223431 11:9370839-9370861 TCTTTTTTTTTGGAGATGGATGG - Intergenic
1078295722 11:10067883-10067905 TCTTTTTTTTATTCGGGGGAGGG - Intronic
1078394562 11:10969028-10969050 TTTTTTTTGTAATAAGTAGAAGG + Intergenic
1078628403 11:12979599-12979621 TTTTTTTTTTAGTGAGAGGAAGG - Intergenic
1078894443 11:15585374-15585396 TTTTTTTTTTTTTAAGAGGAAGG + Intergenic
1079304063 11:19307119-19307141 TTTTTTTCTTAGCAAGTTGAAGG + Intergenic
1079427257 11:20355529-20355551 TCTTTTTATCTGTAAGTTGAGGG - Intergenic
1079970294 11:27028320-27028342 ACTTTTTCTTAGTAATTGGTAGG + Intergenic
1079992765 11:27263981-27264003 TTTTTTTTTTAGGAAATAGAAGG - Intergenic
1080282444 11:30573423-30573445 TTGTTTTTTTAATAAGTAGAAGG - Intronic
1080478030 11:32616418-32616440 TCTTGTTTTTAGTAATGGGGTGG - Intronic
1080590027 11:33715087-33715109 TAATTTTTTTAGTAAGTAGAAGG + Intronic
1081247080 11:40780791-40780813 TTTTTTTTTTAATACGAGGAAGG + Intronic
1081470268 11:43363507-43363529 TCTTTTTCTTCATAATTGGAGGG + Intronic
1082952475 11:58831976-58831998 TCTTTTTATTAGAAATTGGGAGG + Intergenic
1083151533 11:60794670-60794692 TCTTTTTTTTTGGAAGGGGCGGG + Intronic
1083480134 11:62938831-62938853 TCTTTTTTTTTGGGAGTCGACGG + Intronic
1084617936 11:70248879-70248901 TGTTTTATTTCTTAAGTGGACGG - Intergenic
1084718212 11:70887366-70887388 TTTTTTTTTTTTTAAGAGGAAGG + Intronic
1084753074 11:71216890-71216912 TTTATTTTTTAATAAGTAGAAGG - Intronic
1085142482 11:74159304-74159326 ACTTTGTTTTAATAAGTAGAAGG - Intronic
1085308029 11:75499405-75499427 TTTTTTTTTTTTTAACTGGAAGG + Intronic
1086888601 11:92229805-92229827 TTTTTTTTCTGCTAAGTGGAAGG + Intergenic
1087487363 11:98772661-98772683 TCTTTTTTTTAATAACTGTGGGG + Intergenic
1087620155 11:100531512-100531534 TCTTTTTTGTGGCAAGTGAATGG - Intergenic
1088207265 11:107407388-107407410 TTTTTTTTTTGGTAGGGGGAAGG - Intronic
1089888197 11:121851064-121851086 TCTTTTTATTAGTATCTGCATGG + Intergenic
1091745709 12:2991655-2991677 TCTTTTTTTTTGTGGGGGGACGG - Intronic
1091952066 12:4601717-4601739 TCTTTTTTTTAGTAAGGATATGG + Intronic
1091953969 12:4620895-4620917 TAATTTTTTTAATAAGTAGAAGG - Intronic
1092498422 12:9021918-9021940 TTTTTTTCTTAATAAGTAGAAGG + Intergenic
1092532904 12:9360189-9360211 TGTTTTTCTTAGTTAGTGGGAGG - Intergenic
1093295815 12:17389992-17390014 TCTTTTTTTTTGTATTTAGATGG - Intergenic
1093793002 12:23277153-23277175 ACTTTTTCTTTGTAAGTAGAAGG - Intergenic
1093956383 12:25224171-25224193 TTTTTTTTTTAGTAAATAGGAGG - Intronic
1093959936 12:25261249-25261271 TTTTTTTTTTTTTAAGTGAATGG + Intergenic
1094105631 12:26808400-26808422 TTTATTTTTTAGTATGTGGCAGG - Intronic
1094262302 12:28515005-28515027 TCTTTTTTTAAAAAAGTTGAGGG - Intronic
1094435088 12:30412492-30412514 TCTTTTTGTGAGTAGGTTGATGG - Intergenic
1094566273 12:31601069-31601091 TTTTTTTTTTTTTAACTGGACGG - Intergenic
1094737220 12:33248671-33248693 ACTTCTTTTTAATAAGTGGGAGG + Intergenic
1095170724 12:39032830-39032852 CATTTTTTTTTGTAAGTAGAAGG - Intergenic
1095443588 12:42262006-42262028 TCTTTTTATTATGAAGTGAAAGG + Intronic
1095590616 12:43899386-43899408 ACTTATTTTTAGTATGTGGTTGG + Intronic
1095634005 12:44409857-44409879 TCTTATTTTTGGTAGGAGGAGGG + Intergenic
1095812707 12:46387445-46387467 TATTTTTTTAAGCAAGTTGATGG + Intergenic
1096302242 12:50440427-50440449 TTTTCTTTTTAGGAAGTGAAAGG + Exonic
1096939771 12:55329518-55329540 TCTTTTTATTAGAATGTTGAAGG + Intergenic
1097422469 12:59397315-59397337 TTTTTTTTTTCATAAGTAGAAGG - Intergenic
1097710986 12:62916918-62916940 TTTTTTTTTTTTTAAGTAGAGGG - Intronic
1097764951 12:63515112-63515134 GCTTTGTCTTACTAAGTGGAGGG + Intergenic
1097781451 12:63710738-63710760 TTTTTTTTTTGATAAGTAGAAGG - Intergenic
1098074036 12:66707491-66707513 TTTTTTTTTTAGTCAGTGATTGG - Intronic
1098215969 12:68220043-68220065 TCTATTTTTTAGTAGATGCAAGG - Intronic
1098351447 12:69565822-69565844 TTTTTTTTTTAATAAGTAGAAGG + Intronic
1098448876 12:70596506-70596528 TTTTTTTTTAAGAAAGTGAAAGG - Intronic
1099021422 12:77409326-77409348 TTTTTTTTTTTATAAGAGGAAGG + Intergenic
1099231873 12:80036110-80036132 TTTTTTTTCTATTCAGTGGATGG + Intergenic
1099595766 12:84663260-84663282 TTTTTTTTTTAACAAGTTGAAGG - Intergenic
1099832563 12:87863727-87863749 TCTTTTCTTTTGAAAGGGGATGG + Intergenic
1100961999 12:99973043-99973065 TCTTTTTTTCTGTGAGTGGTAGG - Intronic
1100969300 12:100050484-100050506 TTTTTTTTTAAGTAAATGAAAGG - Intronic
1101177577 12:102171153-102171175 TTTTTTTTTAAATAAGTAGAAGG + Intronic
1101281898 12:103266316-103266338 TCTTTATTTTAGAAAGTGGATGG + Intronic
1101761366 12:107661480-107661502 TTTTTTTTTTTGAAAGAGGAAGG - Intergenic
1101836514 12:108299461-108299483 TCCTTCCTGTAGTAAGTGGAAGG + Intronic
1102771578 12:115481804-115481826 CCATCTTTTTAGTAAGTTGAAGG - Intergenic
1103031933 12:117622564-117622586 CCTTTGTTTAAGTCAGTGGAAGG - Intronic
1103612266 12:122131074-122131096 TGTTTTTTGTAGTAACTGCAAGG + Intronic
1103680418 12:122689480-122689502 TTTTTTTTTTTGGTAGTGGAGGG + Intergenic
1103869904 12:124084030-124084052 TCTTTTTTTTAGGGGGAGGACGG + Intronic
1104204380 12:126623108-126623130 TTTTTTTTTAAATAAGTGGAAGG + Intergenic
1104812111 12:131625660-131625682 ACTTTGGTTTAGAAAGTGGAAGG - Intergenic
1105533908 13:21246186-21246208 ACTTTATATTAGTCAGTGGAAGG - Intergenic
1106085328 13:26536684-26536706 TCTTCTTGATAGCAAGTGGAAGG - Intergenic
1106241860 13:27919339-27919361 TCTTTTTTTTAAAAAATTGAAGG - Intergenic
1106273454 13:28178009-28178031 TCAATGTTTTTGTAAGTGGAGGG + Intronic
1107180239 13:37449922-37449944 TATTTTTTTTCCTGAGTGGATGG - Intergenic
1108803193 13:54125122-54125144 GTTTTTTTTTAATAAGTAGAAGG - Intergenic
1108960656 13:56224223-56224245 TGTTTTTCTTAGTAATTGGTTGG - Intergenic
1109170232 13:59086578-59086600 TTTTTTTTTTAATAAGTAGAAGG - Intergenic
1109310047 13:60683026-60683048 TTTTTTTTTAAGTGAGAGGAAGG - Intergenic
1109431549 13:62242399-62242421 ACTTCTTTTTAATAAGTAGAAGG + Intergenic
1109744292 13:66601997-66602019 CTTTTTTTTTAATAAGTAGAAGG - Intronic
1109804470 13:67420208-67420230 TCTTTTTTTTATTAATAGGCTGG - Intergenic
1109930406 13:69208838-69208860 TCTCCTTTTTATTAAGTAGAAGG - Intergenic
1110449722 13:75627943-75627965 TTTTTTTTTTAACAAGTAGAGGG - Intronic
1110639052 13:77800576-77800598 TCTTTTTATTATTAATTGGCTGG + Intergenic
1110701857 13:78558037-78558059 TTTTTTTTTTGGTAAATGGTTGG + Intergenic
1111129231 13:83953118-83953140 TTTGTTTTTTAGTATGTGAATGG - Intergenic
1111269079 13:85856224-85856246 ACATTTTTTTAATAAGTAGAAGG + Intergenic
1111677220 13:91401537-91401559 TGTTTGTTTTAGTCAGTGAAAGG - Intronic
1111756398 13:92401182-92401204 TTTTTTTTTTAGGAAATTGAAGG + Intronic
1111944096 13:94645505-94645527 TTTTTTTTTAAGTAAATGAAGGG + Intergenic
1113466312 13:110515732-110515754 TTTCTTTTTAAATAAGTGGATGG - Intergenic
1113529388 13:111010178-111010200 TTTTTTTTTTAATAAGGAGAAGG - Intergenic
1114476987 14:23002722-23002744 TCTTTTTTTTTTTAAGAGGCGGG + Intronic
1115290782 14:31769782-31769804 TTTTTTTTTCAGTAGTTGGAAGG + Intronic
1115348509 14:32368050-32368072 TCTTTTTTCTAGAAATTTGAAGG + Intronic
1115420959 14:33195219-33195241 TTTTTTTTTTAGCTAGTGGGTGG - Intronic
1115930795 14:38491108-38491130 ACTTTTTTTTAATAAGTAAAAGG + Intergenic
1116630179 14:47320661-47320683 TCTCTTTATTAGTATTTGGAAGG - Intronic
1118117256 14:62794390-62794412 TTTTTTTTTTTGTAATTTGATGG + Intronic
1118252898 14:64179733-64179755 TCTTTTTCTTATTGAGTTGAAGG + Intronic
1119314705 14:73683184-73683206 GCTTTTTTTTAATAAGTAGAAGG + Intronic
1119829741 14:77691144-77691166 TCTTTTTTTTCCAAAGTGAATGG - Intronic
1120712993 14:87812268-87812290 CATTTTGTTTAATAAGTGGAAGG + Intergenic
1120742359 14:88122129-88122151 TTTTTTTTTAGGTAAGTGAAAGG - Intergenic
1120839673 14:89073895-89073917 TATTTTTTTTCCTAAATGGATGG - Intergenic
1121136557 14:91504149-91504171 TCTTTTTTTTAAGAGATGGAAGG - Intronic
1121325944 14:93019699-93019721 TCTCTTTTCTAGCTAGTGGAGGG - Intronic
1123825257 15:24075136-24075158 ACTTTTTTTTAATTAGTAGAAGG - Intergenic
1125099042 15:35889092-35889114 CCTTTTTTTTAGTAACAGAATGG - Intergenic
1125215526 15:37269258-37269280 TTTTTTTTTTTCCAAGTGGAAGG + Intergenic
1125296914 15:38212989-38213011 TCTCTTTTTTAGTGAGTGTGGGG - Intergenic
1125642862 15:41246224-41246246 TCTTCTTTGTAGAAAGTGGGTGG + Intronic
1125704624 15:41722517-41722539 CCTTTTTTATAGGAAGGGGAGGG + Intronic
1125893545 15:43283479-43283501 TCTTTTTTTTTGTAAATGTAAGG + Intronic
1126006855 15:44266122-44266144 TCTTTTTTTTTTTAAGAGGCAGG - Intergenic
1127160332 15:56176791-56176813 GATTTTTTTTTGTAAGTAGATGG - Intronic
1127610936 15:60635721-60635743 TCTGTTTCTAAGGAAGTGGAGGG - Intronic
1127664803 15:61135134-61135156 TTTTTTTTTTAGTAAGAGATGGG - Intronic
1127887892 15:63219452-63219474 TTTTTTTTTTTTTAAATGGAGGG + Intronic
1127887969 15:63220449-63220471 ACTTTTTTTTTTTAAATGGAGGG + Intronic
1128734609 15:70046062-70046084 TCTGTTTTTTAAAAAATGGAGGG - Intergenic
1129043700 15:72713528-72713550 TCTTTTTTTTAGTAAGTGGAAGG + Intronic
1129119063 15:73384135-73384157 TCTTTTTCTTATTGAGTTGAAGG + Intergenic
1129280818 15:74483614-74483636 TTTTTTTTTTAGTAAGAGACAGG - Intergenic
1129490621 15:75921996-75922018 TTTTTTTTTTAATAAGTAGGAGG + Intronic
1129571948 15:76697199-76697221 TCATTTTTTTAATCAGTAGAGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131674412 15:94656223-94656245 TAATTTTTTTAATAAGTAGAAGG - Intergenic
1132008221 15:98250043-98250065 TCTTTTATTTGGAAAGTGGAAGG - Intergenic
1132165094 15:99579308-99579330 TTTTTTTTTCGGTCAGTGGAGGG + Intronic
1133599868 16:7328633-7328655 TTTTTTTTTTTTTAGGTGGAGGG + Intronic
1133683734 16:8146199-8146221 TCTTTTTTTTAATCAGTACATGG + Intergenic
1134157916 16:11859028-11859050 ACTTTTTTTTTATAAGTAGAAGG - Intergenic
1134162033 16:11899329-11899351 TCTTTTTTTTTTTAAGTGACAGG + Intronic
1134357697 16:13499858-13499880 TCTTTGTTTGGGTAAGTAGACGG - Intergenic
1135162200 16:20106779-20106801 TTTTGATTTTATTAAGTGGAAGG - Intergenic
1136018202 16:27419732-27419754 TTTTTTTTTAAGTAAGTACAAGG + Intronic
1136521773 16:30801356-30801378 TCTTTTTTTTAGAGAGAGAAAGG + Intergenic
1136588637 16:31203375-31203397 TCTTTTTTTTAATCAGTGTTGGG - Exonic
1137006278 16:35276663-35276685 TCCTTTGTTTAGAAAGGGGAGGG + Intergenic
1137403831 16:48174995-48175017 TTTATTTTTTAGAAACTGGATGG - Intronic
1137504409 16:49040620-49040642 TTTTTTTTTTAGTATCTGCAAGG + Intergenic
1138244798 16:55459628-55459650 TCTATTTTTTTGTAGGGGGAGGG - Intronic
1139217529 16:65142703-65142725 TCTTTTTATTAGTTATTGGCAGG - Intergenic
1139843462 16:69901378-69901400 TCTTTTCTTTAGGATGTGAAAGG + Intronic
1140193668 16:72838904-72838926 TTTTTTTTTTAATAACTGAAAGG + Intronic
1140489549 16:75323439-75323461 TTTTTTTTTTAACAAGTAGAAGG + Intronic
1140851770 16:78941465-78941487 TTTTTTTTTTTGTCAGTAGAGGG + Intronic
1142831648 17:2553617-2553639 TCTTTTTTCTGGTTATTGGAGGG - Intergenic
1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG + Intergenic
1143611915 17:8022819-8022841 TGTTTTTTCAAGAAAGTGGAAGG + Intergenic
1144113117 17:12058234-12058256 TTTTTTTTTTTTTAAGTGGCAGG + Intronic
1144552725 17:16255642-16255664 TTTGTTTTTTTGTAAGGGGAAGG - Intronic
1145081157 17:19895438-19895460 TCTTTTTTGTGGTGAGTGCATGG + Intergenic
1145082078 17:19902475-19902497 TATTTTTTTTAGTAAGAGACAGG + Intergenic
1146643369 17:34558088-34558110 CATTTTTTTTAATAAGTAGAAGG - Intergenic
1147041953 17:37726262-37726284 TCATATTCTTAGTAAGTGGTGGG - Intronic
1147586855 17:41657819-41657841 TCTTTTTTTGAGTAAGCAGAGGG - Intergenic
1148359971 17:47003623-47003645 TCTTTTTTTAATTACGTGGATGG + Intronic
1148653573 17:49266979-49267001 TTTTTTTTTTAGTAAGAGACGGG - Intergenic
1149038897 17:52163492-52163514 TCTTTTTTTTATATAGTGTAAGG - Intergenic
1149056153 17:52368719-52368741 TTTTTTTTTTACAAATTGGAAGG + Intergenic
1149389526 17:56174939-56174961 TTATTTTTTTATTAAGTGGGAGG + Intronic
1151008525 17:70465299-70465321 TTTTTTTTCTAATAAGTAGAGGG + Intergenic
1151169051 17:72231090-72231112 TCTTCTTTTGAGGAAGTGGGTGG + Intergenic
1152370138 17:79882326-79882348 TCTTTTTTTAAGCAGGTGGGGGG + Intergenic
1152469920 17:80485313-80485335 TATTTTTTTTTTTAAGTTGATGG + Intergenic
1152972229 18:173586-173608 TATTTTTTTTAGTATGTTGTTGG + Intronic
1153343048 18:3995154-3995176 TCCTTTTTTTAGGTAGTGGCTGG + Intronic
1153751386 18:8234729-8234751 TCTTTTTTTTATCAAGTTGAGGG + Intronic
1153799142 18:8653805-8653827 TCTTTTTTGTAGAGAGTGCAAGG - Intergenic
1153937898 18:9947168-9947190 TTTTTGTTTTCGTAAGTAGAAGG + Intronic
1153953897 18:10079933-10079955 TTCTTTTTTTGGTAAGTAGAAGG + Intergenic
1153955685 18:10093868-10093890 TTTTTTTTTTGGTAAGTAGAAGG - Intergenic
1153997999 18:10458476-10458498 TCTTTTTATGACTAAGAGGAGGG - Intronic
1154269018 18:12903283-12903305 ACTTTTTTTAAATAAGTTGAAGG - Intronic
1154301783 18:13200457-13200479 TTTTTTTTTTAGTGAGTAGCTGG + Intergenic
1154928371 18:20964118-20964140 TTTTTTTTTAAGTAGTTGGATGG - Intronic
1154969183 18:21390282-21390304 TTTTTTTTTTAATAAGTAGAAGG - Intronic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1155194235 18:23458285-23458307 TCATATCTTTAGGAAGTGGAAGG + Intronic
1155520847 18:26667613-26667635 TATTTTTTTTAATACGAGGAAGG + Intergenic
1156249748 18:35341487-35341509 TTTTTTATTTAGTAAGTAGAAGG - Intronic
1156832893 18:41516333-41516355 TACTTTTTTTTTTAAGTGGAGGG + Intergenic
1157102733 18:44744760-44744782 TTTTTTTTTTTTTAAGAGGAGGG - Intronic
1157774064 18:50377043-50377065 TTTTTTTTTTAATAGGTAGAAGG + Intronic
1158084108 18:53629769-53629791 TTTTTTTTTTAATAAGTAGAAGG - Intergenic
1158521743 18:58176874-58176896 TGTGTTTTTTAGGAAGCGGAAGG + Intronic
1158758773 18:60358886-60358908 CTTTTTTTTTAATAAGTAGAAGG - Intergenic
1159038812 18:63303431-63303453 TCTTTATTTTAATAACTAGAAGG - Intronic
1159056136 18:63465761-63465783 TTTTTTTTTTAGACAATGGAAGG + Intergenic
1159085648 18:63788119-63788141 TTTTATTTTTCGTAAGTAGAAGG - Intronic
1159541102 18:69777740-69777762 TTTTTTTTTTTGTCAGTGAAGGG - Intronic
1159553846 18:69924539-69924561 TTTTTTTTTTTGTAAGTCTAGGG - Intronic
1159835836 18:73334133-73334155 TATTTTTGGTAGTAAGTGAAAGG + Intergenic
1160126516 18:76177799-76177821 TCCTTTTTTTAGTAATTCCATGG + Intergenic
1160145948 18:76364616-76364638 TCTTTCTTTTAGTAAGGCAAGGG + Intronic
1161676658 19:5654356-5654378 TCTTTTCTGTAGGAAGTCGAGGG + Exonic
1161836368 19:6649924-6649946 TTTTTTTTTTGGTAAGTGACAGG + Intergenic
1162243367 19:9377360-9377382 TTTCTTTTTTAGTAAGTAGAAGG - Intronic
1162376291 19:10307352-10307374 TTTTTTTTTTTTTAAGGGGATGG + Intronic
1162768507 19:12934809-12934831 TCTTTTTTTTTGTAAGAGTCAGG - Intergenic
1162829762 19:13277010-13277032 TTTTTTTTTAAGCAAGTGCAGGG - Intronic
1163081632 19:14948034-14948056 TTTTTCTTTTAATAAGTAGAAGG - Intergenic
1163537759 19:17887297-17887319 TCTTTTTTTTGGTGGGCGGATGG + Intronic
1163553437 19:17979131-17979153 TTTTTTTTTTTTTAAGAGGAAGG - Intronic
1164494536 19:28747563-28747585 ACTATTTTTTAGTGATTGGAAGG - Intergenic
1164685879 19:30166405-30166427 TCTTTTTTTTCCCAAATGGAAGG + Intergenic
1165209550 19:34223077-34223099 TCTTTTTTTTGGGGGGTGGAGGG + Intronic
1165342168 19:35220710-35220732 TCTTTTATCTCATAAGTGGAGGG - Intergenic
1165550514 19:36580264-36580286 TTTTTTTTTTAATAAGTAGAAGG + Intronic
1166609796 19:44180926-44180948 TTTTCTTTTCAGTCAGTGGAAGG + Intergenic
1166612515 19:44211820-44211842 TTTTTTTTTTTGGAAGTGGTGGG + Intronic
1166627380 19:44371347-44371369 TTTTTTTTTTTTTAAGTGGCAGG - Intronic
1167003462 19:46759710-46759732 TCTTTTTTTTTGTGGGGGGATGG - Intronic
1167405726 19:49307056-49307078 TTTTTTTTTTTGTTAGAGGAAGG + Intronic
925001730 2:408465-408487 TTTTTTTTTAAGTCAGAGGAGGG - Intergenic
925779430 2:7368173-7368195 TCATTTTTATCATAAGTGGATGG - Intergenic
926664292 2:15503233-15503255 TTTTTTTTTTAGTAAGTAGAAGG + Intronic
926687293 2:15707984-15708006 TCTCTTTTTTTTTAAGTGGTTGG - Intronic
927027553 2:19085203-19085225 TCTTTTTTTTAGACAGTGCCTGG + Intergenic
927274865 2:21254199-21254221 TCTTTCTTTGAGAAGGTGGAGGG + Intergenic
927325236 2:21797859-21797881 TTTTTTTTTTTGTAAAAGGAAGG + Intergenic
927585763 2:24303157-24303179 TTTTTTTTTCTGTAAGTAGAAGG - Intronic
927711808 2:25330792-25330814 TTTTCTTTTTAATAAGGGGAGGG - Intronic
928261896 2:29775526-29775548 TTTTTTTTTTTGTAGGGGGAGGG - Intronic
928721260 2:34124322-34124344 TTTTTTTTTTTTTAAGTTGAAGG + Intergenic
929014421 2:37480737-37480759 TGTTTTTTTCAATAAGTAGAAGG + Intergenic
929548749 2:42875549-42875571 TTTTTTTTTAAATAAGTGTAAGG + Intergenic
930507549 2:52303570-52303592 TTTTTTTTTTTTTAATTGGATGG + Intergenic
930652778 2:53979048-53979070 TTTTTTTTTTAATAAGTAGAAGG - Intronic
931119121 2:59196943-59196965 TCTCTTTGCTGGTAAGTGGACGG - Intergenic
931140299 2:59450396-59450418 TCTTATTTTTAATAAGTAGAAGG - Intergenic
931203254 2:60121762-60121784 TCTTTTTTTTTTTAACTGTAAGG + Intergenic
931316417 2:61136795-61136817 TTTTATTTTTAGTAGGTGCAGGG - Intronic
931654351 2:64497473-64497495 TCTTTTTTTGTGGAAGGGGATGG - Intergenic
931867662 2:66430010-66430032 TCTTTTATTAATTAAATGGAGGG - Intergenic
932181192 2:69647703-69647725 TATTTTTTTTAAAAAGTGGCTGG - Intronic
932192120 2:69749751-69749773 TTTTTTTTTTAGTAAGAGACGGG - Intronic
932385080 2:71324728-71324750 TCTTTTTTTTTTTAAGGGGCAGG + Intronic
932546965 2:72722515-72722537 TCTTTGTTTAAGTAAATGGAGGG + Intronic
932647617 2:73520841-73520863 TCTTTTTTTGAGTAAGTAGCAGG + Intronic
932855911 2:75233935-75233957 TCTGTATTTTGGCAAGTGGAGGG - Intergenic
933891648 2:86777341-86777363 TCTTTTTTTTGGGAAGGGGCGGG + Exonic
934843226 2:97644901-97644923 TTTTTTTTTTAATTGGTGGAGGG + Intergenic
935080468 2:99788229-99788251 ACTTTTTTTTAATGAGTAGAAGG - Intronic
935150765 2:100433114-100433136 TTTTTTTTTTAGTAGGTTCAGGG - Intergenic
935221415 2:101017270-101017292 TATTTTTTTTAATAAGTAGAAGG + Intronic
935224308 2:101039807-101039829 TCTTTTTTTTGGTGAGTGAAAGG + Intronic
935676502 2:105598872-105598894 TTTTTTTTTTTGTTAGAGGAAGG + Intergenic
935765021 2:106358546-106358568 TCTTTCCTTTAGTCAGTGGGTGG + Intergenic
935990694 2:108716526-108716548 TCTTTTTTTTTGTAAGCACAGGG + Intergenic
936123846 2:109770057-109770079 TCTTTTTTTTGGTGTGTGGTGGG - Intergenic
936358521 2:111773760-111773782 AGTGTTTTTGAGTAAGTGGAAGG + Intronic
936434659 2:112493792-112493814 TCATTTTTTTAGTATGGGTATGG + Intronic
936448703 2:112617275-112617297 TATTTTTTTTAGGTAGTGGAAGG + Intergenic
936766199 2:115851516-115851538 TCTGTTTTTAAGTAAGAGGTGGG - Intergenic
937501362 2:122482699-122482721 TTTTTTTTTTAGTAAGATAAAGG + Intergenic
937838606 2:126499947-126499969 TCTTTTGTTTAGTACTTGAATGG - Intergenic
938813558 2:134876652-134876674 AATTTTTTTTAATAAGTAGAAGG + Intronic
938876741 2:135539177-135539199 TTTTTTTTTAAATAAGTAGAAGG + Intronic
939017811 2:136921465-136921487 TTTTTTTTTTAATAAGATGAAGG + Intronic
939024919 2:137000828-137000850 TTTTATTTTTAGTAACTAGAAGG + Intronic
939084122 2:137696801-137696823 TCTTTTTTTTATTAATTGGTGGG - Intergenic
939320664 2:140616094-140616116 TTTTTTTTTTAGTAACTTTATGG - Intronic
939727582 2:145742151-145742173 TTTTTTTTTTATTAATTTGAAGG + Intergenic
939832135 2:147085579-147085601 TCTTTTTCTTGGTTGGTGGAAGG + Intergenic
939929845 2:148219379-148219401 TTTTTTTTTTAATAAGTAGAAGG + Intronic
940070984 2:149687652-149687674 ATTTTTTTTTAGTAAGTTCAGGG + Intergenic
940166473 2:150779256-150779278 ACTTTTCCTTTGTAAGTGGAAGG - Intergenic
940198887 2:151128142-151128164 GCTTTATTTTAGAAAGTTGAGGG - Intergenic
940227439 2:151414487-151414509 TCTCTTGTTTACTCAGTGGAAGG + Intronic
940283634 2:152012086-152012108 TTTTTTTTTTAATAAATAGAAGG - Intronic
940556558 2:155235474-155235496 TCTTTTTTTTATTAGGTTGGGGG - Intergenic
940709881 2:157149048-157149070 TTTTTTTTTTGGAAAGGGGAAGG - Intergenic
941170784 2:162133031-162133053 TCTTTTTTTTTGTTATTAGAGGG + Intergenic
941863855 2:170313364-170313386 TATTTTTTTTAGTATGTATATGG - Intronic
941951961 2:171164947-171164969 TCTTTTTTTTAGATAGAGGTGGG - Intronic
942226300 2:173819467-173819489 TCTTTTCTTTATGAAGTGTAGGG - Intergenic
943099926 2:183475360-183475382 ACTTGTTTTTGGTTAGTGGAGGG + Intergenic
943536049 2:189151995-189152017 TCTGTTTTTGAGTCAGTAGAGGG + Intronic
943635297 2:190300429-190300451 TTTTTTTTTTAATATGTGGTTGG + Intronic
944181182 2:196896540-196896562 TCTTTTATTTTTTAAGTGTAGGG - Intronic
944209471 2:197191790-197191812 TGTTTGTTTTAGTATGTGCATGG - Intronic
945058672 2:205889686-205889708 TTTTTTTTTTTGTAAGTACAGGG - Intergenic
945186285 2:207143408-207143430 TTTTTTTTTTGGTAAATGGAGGG - Intronic
945683492 2:212940645-212940667 TTTTTTTTTTGGTAGGAGGAGGG + Intergenic
945748328 2:213746937-213746959 ACTTTTTTTTGATAAGTAGAAGG - Intronic
945979211 2:216295597-216295619 TCTTTTTGTTAGCATGTGAAGGG - Intronic
946622800 2:221576912-221576934 TCATTTTTTTAATAAGTTGTTGG + Intergenic
946745371 2:222839984-222840006 TTTTTTTTTTAATATGTGAATGG - Intergenic
946992944 2:225356132-225356154 TCTATAATTTAGTATGTGGATGG + Intergenic
947120282 2:226807003-226807025 GCTTTTTTTTCTTAAGTGGTTGG + Intergenic
947948625 2:234128152-234128174 TCTATATTTTAGTAATAGGAAGG - Intergenic
948554775 2:238800912-238800934 TCTATTTTTTAACAAATGGAAGG - Intergenic
949011611 2:241682748-241682770 TCTATTTTTTAGTTAGTGATGGG - Intronic
1168792389 20:588171-588193 ATTTTTTTTTAATAAGTAGAAGG + Intergenic
1169933028 20:10854129-10854151 TTTTTTTTTTTGTTAGTGGGAGG + Intergenic
1170016147 20:11784602-11784624 TTTTTTTTTTACTGAGAGGAAGG - Intergenic
1170599801 20:17832640-17832662 TTTTTTTTTTAATTAGTAGAAGG - Intergenic
1170881479 20:20300276-20300298 ACTTTTTTTTCATAAGTAGAAGG - Intronic
1171167271 20:22982940-22982962 TCATTTTTTTAGTGGGTAGAAGG - Intergenic
1171181563 20:23094695-23094717 TCTGTTTCTTAGGAAGTGGGGGG + Intergenic
1171473133 20:25388066-25388088 TCTTTTTTTTTGTAGGATGAAGG - Intronic
1171864199 20:30467649-30467671 TCTTTTTTGTAGTATCTGCAGGG - Intergenic
1172524492 20:35590743-35590765 TTTTTTTTTAAATCAGTGGAGGG + Intergenic
1173492588 20:43495144-43495166 TCTTTTTTTTTTTAAGTGAGTGG + Intergenic
1174673407 20:52330189-52330211 TCTGTTTTTCAGTGAGGGGAAGG + Intergenic
1174962104 20:55170117-55170139 CCTTTTTTTGAGAAAGTGGAAGG + Intergenic
1175208295 20:57328881-57328903 TCTTTTTTTTTTTAAGTGAAAGG - Intergenic
1175366403 20:58459357-58459379 TTTTTTTTTTTTTAAGAGGAAGG + Exonic
1175582183 20:60108772-60108794 TTTTTTTTTTAGTAAGTAGAAGG - Intergenic
1175850565 20:62089480-62089502 TTTTTTTTTTAATAAGTAGAAGG - Intergenic
1177009418 21:15713947-15713969 TCATTTTTTTACTAAATGGTTGG - Intergenic
1177080396 21:16632088-16632110 TATGTTTTCTACTAAGTGGATGG - Intergenic
1177182045 21:17755205-17755227 TTATTTTTTTAGTACGTTGATGG + Intergenic
1177737948 21:25116445-25116467 ACTTTTTTTTAATAAGTAGGAGG + Intergenic
1178514961 21:33238765-33238787 TTTTTTTTTTTTTAAGTAGAAGG - Intronic
1178946750 21:36954731-36954753 TTGTTTTTTTAATAAGTAGAAGG - Intronic
1179153204 21:38827196-38827218 TCTTTTTTTCTGCAAGTGCATGG + Intergenic
1179230062 21:39494250-39494272 TCTTTTTTTTTTTAAGTAGGAGG + Intronic
1179295031 21:40054158-40054180 TCTTTTTTTGGGAAAGGGGAAGG - Intronic
1179318371 21:40267266-40267288 TTTTTTTTTTTATAAGTAGAAGG + Intronic
1180129321 21:45816745-45816767 TTTTTTTTTTAATAAATAGAAGG + Intronic
1180733264 22:17997917-17997939 TTTTTTTTTTTGGAAGCGGAAGG - Intronic
1181166346 22:20985373-20985395 TCTTTTTTTTAAGAAGTGGCAGG + Intronic
1181517978 22:23427078-23427100 TTCTTTTTTTTGGAAGTGGAAGG - Intergenic
1181777902 22:25172657-25172679 TGTTCTTTTTAATATGTGGATGG + Intronic
1182051504 22:27316007-27316029 TCTTTTTCTGAGCAAGTGGGAGG - Intergenic
1182254597 22:29029331-29029353 TCTTATTTTTATGAAGAGGAAGG - Intronic
1182258824 22:29058103-29058125 CCTTATTTTTATAAAGTGGATGG - Intergenic
1182653939 22:31874517-31874539 GATTTTTTTTAATAAGTGGGAGG + Intronic
1183818511 22:40324293-40324315 TTTTTTTTTTTTTAAGTGAATGG + Exonic
1184356432 22:43983321-43983343 TCAATTTTTCAGAAAGTGGATGG + Intronic
1184705203 22:46207216-46207238 TCTTTTTTTTTGCAGGGGGATGG - Intronic
1185007034 22:48285634-48285656 TTTTTTTTTTTGCATGTGGATGG - Intergenic
949391717 3:3569621-3569643 TTTTTTTTTTAACAAGTTGAAGG + Intergenic
949849545 3:8409139-8409161 TTTTTTTTTAAATAAGTAGAAGG - Intergenic
950245700 3:11415766-11415788 TTTTTTTTTAAATAAGTAGAGGG + Intronic
950532461 3:13560240-13560262 TCTTTTTTTTAGGGAGGAGAGGG + Intronic
951561703 3:23974102-23974124 TTTTTTTTTTTTTAAGTAGAAGG + Intronic
951651462 3:24955684-24955706 CCTTTTTTTTAGGGGGTGGAAGG + Intergenic
951943311 3:28106395-28106417 ACTTTTTTTTAATAAGTAGAAGG - Intergenic
952060232 3:29499318-29499340 TCTTTTCTTTACTAAAGGGAAGG - Intronic
952373761 3:32747953-32747975 TCTTTTTTTTTGGAGGTGGGGGG - Intronic
952414589 3:33079411-33079433 TATTTATTTTAGCAAGAGGAGGG + Intronic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
954174184 3:48830449-48830471 AACTTTTTTTAGTAAGTAGAAGG + Intronic
954740606 3:52747148-52747170 TCTTTTGTTTTCTAAGAGGAAGG - Intronic
954768652 3:52945127-52945149 TTTTTTTTTTTTTAATTGGAAGG - Intronic
955013188 3:55040083-55040105 TCTCTTCTTTAGTTAGTGAATGG + Intronic
956712868 3:72053588-72053610 AATTTTTTTTAATAAGTAGAAGG - Intergenic
956992561 3:74784105-74784127 TCTTTTTTTAAGTGAGATGAGGG - Intergenic
957440175 3:80236121-80236143 TTTTTTTTCTAGCAATTGGAGGG + Intergenic
957441930 3:80259561-80259583 TTTTTTTTTAAATAAGTAGAAGG + Intergenic
957564915 3:81872031-81872053 ACTTTTTTTTACTAAGAGCATGG - Intergenic
957839387 3:85647755-85647777 TCATTTTTTTAATAAGGGGTAGG - Intronic
957936141 3:86945093-86945115 TCATATTATTAGTGAGTGGAAGG + Exonic
958132628 3:89448373-89448395 TCTTTTGTTTCGTAAGTGTCAGG - Intronic
958208977 3:90443533-90443555 TCTTTTTTTTAGAATATGCAAGG - Intergenic
958437754 3:94118681-94118703 TTTTTTTTTAAATAAGAGGAAGG - Intronic
958708328 3:97685726-97685748 TCTCTTTCTGAGTAAATGGAGGG - Intronic
958711086 3:97717774-97717796 TATTTTTTTCTGTAAGGGGAAGG - Intronic
959251317 3:103951057-103951079 TTTTTTTTTTAATAAGTAGAAGG - Intergenic
959301010 3:104600982-104601004 TATTTTTTTTAATAAGTGCAAGG - Intergenic
959396905 3:105852108-105852130 GCTGTTTTTTAATAAGTAGAAGG - Intronic
959610147 3:108284919-108284941 TTTTTATTGTACTAAGTGGAAGG - Intergenic
960204371 3:114877215-114877237 TCTATTTTTTAATAAATGAATGG - Intronic
960352765 3:116613001-116613023 TTTTTTTTTAAGTAAGTGAGAGG - Intronic
960619188 3:119622766-119622788 TTTTTTTTTTACTAAGGGGTAGG - Intronic
960665718 3:120107041-120107063 TCTATTTTTTAGTAAAGGCAGGG - Intergenic
960755631 3:121008934-121008956 TTTTTTTTTTACCAAGTGGGTGG + Intronic
960819072 3:121707625-121707647 TTTTTTTTTTAGTAAGAGACAGG - Intronic
960869140 3:122231747-122231769 TTTTTTTTTTTGTGAGTGGGAGG - Intronic
961348719 3:126284503-126284525 TTTTTTTTTAAATAAGTAGAAGG + Intergenic
961354076 3:126323296-126323318 TTTTTTTCTTAGTAAATTGAAGG + Intergenic
961994278 3:131224563-131224585 AATTTTTTTTAATAAGTAGAAGG - Intronic
962115759 3:132505693-132505715 TCTTTTCGCTAGTAAGTGAAAGG + Intronic
962202454 3:133413009-133413031 TCTGTTTCTTAGAAAGTGGAGGG + Intronic
962225740 3:133606020-133606042 TTTTTTTTTTGGCAAGGGGAAGG - Intronic
962530493 3:136276204-136276226 TATTTTATTTACTAAGTTGATGG + Intronic
962569724 3:136700747-136700769 TCATATTTTCAGTAACTGGAAGG - Intronic
963711124 3:148748708-148748730 TAATTCTTGTAGTAAGTGGATGG + Intergenic
963807259 3:149736024-149736046 TTTTTTTTTTAGTATTTGGGGGG - Intronic
963925500 3:150946557-150946579 CTTTTTTTTTAATAATTGGAAGG + Intronic
964014169 3:151926382-151926404 ACCTTTTTTTATTATGTGGAAGG + Intergenic
964567588 3:158074389-158074411 TGTTATTTATAGGAAGTGGAAGG + Intergenic
964761898 3:160142226-160142248 TCTTTTTTTCTGAAAGTGGCAGG + Intergenic
964779153 3:160315829-160315851 TCTTTTTTTTAGAAAGGGGATGG + Intronic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
965687712 3:171322844-171322866 TTTTTTTTTTTTTAAGTGCAAGG + Intronic
966387287 3:179412839-179412861 TTTTTTTTTTCCAAAGTGGAGGG - Intronic
966525511 3:180914567-180914589 TCCTTTTTTTAATAAGGTGAAGG + Intronic
967138051 3:186529217-186529239 TCTTTTCTCTACTAAGTAGAAGG + Intergenic
967149994 3:186639724-186639746 TCTTTCTTTTAGCAAGAGTATGG + Intronic
967303910 3:188042511-188042533 TCTTCTTATTTGTAAGTGAAAGG - Intergenic
967389625 3:188942926-188942948 TATTTTTTATAGTCAGAGGAAGG + Intergenic
967501126 3:190199335-190199357 TTTTTTTTTTAATAAATTGAAGG + Intergenic
967681394 3:192368098-192368120 TGTTTTTTTTTGGAAGGGGAGGG - Intronic
967701333 3:192595684-192595706 TCATTGTTGTAGTAAGTGGTAGG + Intronic
968160092 3:196419497-196419519 GCTTTGTTTAAGAAAGTGGATGG - Intronic
969179580 4:5427427-5427449 TATTTTTTTTAGAAAATAGAAGG - Intronic
970040168 4:11787360-11787382 TCTTTTTGATTCTAAGTGGAAGG - Intergenic
970157456 4:13155342-13155364 TTTTTTTTTTTGAAAGTAGAAGG - Intergenic
970412650 4:15824427-15824449 TTTTTTTTTTAGTAGGGGTAGGG + Intronic
970551032 4:17181314-17181336 CCTTTTTTTTAATAAGTAGAAGG - Intergenic
970759241 4:19464257-19464279 TTTTTTTTTTAATGAGTGGTTGG + Intergenic
970950006 4:21743633-21743655 TCCTTTTTTTTGTAGGGGGAGGG + Intronic
971456699 4:26851888-26851910 TCTTTTATTTACTTAGTGCATGG + Intergenic
971767367 4:30850527-30850549 TTTCTTTTTTATTAGGTGGAGGG + Intronic
971887974 4:32477178-32477200 TTTTTTTTTTAATATCTGGAGGG - Intergenic
972062303 4:34891148-34891170 TCTATTTTTTAGAAATTGGCTGG + Intergenic
972461856 4:39311601-39311623 TTTTTTTTTTTGTAAGAGAAGGG - Intronic
972751640 4:41995254-41995276 TCTTTTTTTTGGTGGGGGGACGG - Intronic
973758468 4:54097056-54097078 ATTTTTTTTTTGTAAGTTGAGGG + Intronic
974432907 4:61821177-61821199 TTTTTTTTTTGGTAATTGGCAGG - Intronic
974855341 4:67454095-67454117 TTTTTTTTTTAATAAGTAGAAGG + Intergenic
974945966 4:68529265-68529287 GCTTTTTGTTAGCAAGTGAAGGG - Intergenic
975197577 4:71543356-71543378 TCTTTTTGTTCTTAAGGGGAAGG - Intronic
975476665 4:74831380-74831402 TCTTTTATTTCACAAGTGGAGGG + Intergenic
977155256 4:93564563-93564585 TCTGCTTTTTAATAAGTGGATGG + Intronic
977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG + Intergenic
977573006 4:98649142-98649164 TCTTTTCTTTCTTAAGTGGTGGG + Intronic
978254984 4:106682243-106682265 TCTTTAATTTAGTAATAGGAGGG - Intergenic
978342560 4:107734005-107734027 TTTTCTTTTTAGTAATGGGAGGG - Intergenic
978454302 4:108871150-108871172 TGTTTCCTTTAGTAAGTGTATGG + Intronic
978752442 4:112266069-112266091 TCTTTTTTTTGGAAAGGGAAGGG - Intronic
978827153 4:113039126-113039148 TTTTTCTTTTACTAAATGGAAGG + Intronic
979098282 4:116578710-116578732 TCTTTTTTCTCTTAAGTGGATGG - Intergenic
979351640 4:119650485-119650507 TGTTTTTTTAAGAAAGTGGATGG + Intergenic
979607908 4:122658324-122658346 TTTTTTTTTTGGTGAGGGGATGG - Intergenic
979689380 4:123544280-123544302 TCTTTTATTTATTTAGTCGATGG + Intergenic
979962111 4:127033598-127033620 TGTTTATTTTAGTTATTGGATGG - Intergenic
980069743 4:128230921-128230943 TTGTTTTTTTAATAAGTAGAAGG - Intergenic
980143902 4:128956779-128956801 TCTTTATTTTATCCAGTGGAGGG + Intronic
980375493 4:131941426-131941448 TTTTTTTTTTCTGAAGTGGATGG - Intergenic
980645627 4:135638822-135638844 TTTTTTTTTTAGAAATTTGAAGG + Intergenic
980734379 4:136866432-136866454 TAGTTTTTTTATTAACTGGAAGG + Intergenic
981811329 4:148779000-148779022 TTTTTTTTTTAATAGGTAGAAGG + Intergenic
981867095 4:149435560-149435582 TTTTTTTTTTAATAAGTAGAAGG - Intergenic
981950650 4:150402912-150402934 TCTTTTTTTTTGGAGGTGGGTGG + Intronic
982905522 4:161064512-161064534 GTATTTTTTTAATAAGTGGAAGG + Intergenic
983043707 4:162959683-162959705 TTTTTTTTTTTTTAAATGGATGG + Intergenic
983480013 4:168261522-168261544 TATTTGTTTTAATAAGTTGATGG - Intronic
983659152 4:170115059-170115081 TTTTTTTTTTAATAAGGGGAAGG + Intergenic
983916204 4:173294275-173294297 TTTTTTTTTTTTTAAGTTGAAGG + Intronic
984047797 4:174823208-174823230 TTGTTTTTTTATTAGGTGGATGG - Intronic
984177985 4:176443080-176443102 TCTTTTTTTTAGAAAAAGAAAGG - Intergenic
984936617 4:184895374-184895396 TCTTTTTTGTAGGATGGGGAGGG + Intergenic
985007922 4:185552826-185552848 TCTTATTTATAGTAAATGCAGGG + Intergenic
985768135 5:1791995-1792017 GCTTTTGTTGAGTAAGTGGCTGG - Intergenic
986133241 5:4949869-4949891 TAATTTTTTTACAAAGTGGAAGG + Intergenic
986222188 5:5778026-5778048 TCCTTTTTATAGTAAGTGTGTGG + Intergenic
986296773 5:6445992-6446014 ATTTTTTTTTTGTAAGTGGAAGG - Intergenic
986641607 5:9877227-9877249 CTTATTTTTTAGAAAGTGGATGG + Intergenic
986761760 5:10886230-10886252 TTTTTTTTTTGACAAGTGGATGG + Intergenic
986972258 5:13350509-13350531 TCTTTTATTTGGTAAGAGGAAGG - Intergenic
987350525 5:17017876-17017898 TCTTTTTTTTTGGAGGGGGATGG + Intergenic
987425724 5:17770755-17770777 TCTTTTTTTTTGTATATAGAAGG + Intergenic
987484395 5:18506205-18506227 TAATTTTTTTAATAAGTAGAAGG - Intergenic
987744242 5:21949189-21949211 TATTTCTTTTAATAAGTAGAAGG - Intronic
987818466 5:22932791-22932813 TCTTTTTTTTTTTAATAGGAAGG - Intergenic
987969440 5:24923154-24923176 TCTTATTTTTTAAAAGTGGAAGG + Intergenic
988028657 5:25733091-25733113 TTTTGTTTATACTAAGTGGATGG - Intergenic
988739160 5:34052898-34052920 TTCTTTTTTTAGTAATTGGCTGG + Intronic
988780615 5:34518286-34518308 TCTTTTTGTTATTAGGTGGCAGG - Intergenic
988793032 5:34626464-34626486 TTTTTTTTTAAATAAGTAGAAGG - Intergenic
988960102 5:36361710-36361732 TTTTTTTTTTTGTAAGTAGAAGG + Intergenic
989628275 5:43454221-43454243 TTTTTTTTTTAGGAAGAGCAGGG + Intronic
990011304 5:51002399-51002421 TCTTTTCTTTCCTAAGTGGGTGG - Intergenic
990091004 5:52048949-52048971 TTTTTTTTTTAATAAATAGAAGG - Intronic
990667480 5:58090070-58090092 TCTATTTTTCTGTAAGTAGAAGG - Intergenic
991185977 5:63808067-63808089 TCTTTTTTTTAGTCTGTAGGTGG - Intergenic
991686170 5:69184350-69184372 TTTTTTTTTTTGTAAGAGGCAGG - Intergenic
991726192 5:69538012-69538034 TTTTTTTTTTAATAAGTTGAAGG + Intronic
991764446 5:69959326-69959348 TATTTCTTTTAATAAGTAGAAGG - Intergenic
991782878 5:70158821-70158843 TATTTCTTTTAATAAGTAGAAGG + Intergenic
991843678 5:70834398-70834420 TATTTCTTTTAATAAGTAGAAGG - Intergenic
991868764 5:71089862-71089884 TTTTTTTTTTAATAAGTTGAAGG - Intergenic
991875321 5:71159148-71159170 TATTTCTTTTAATAAGTAGAAGG + Intergenic
991962484 5:72059161-72059183 TCTTTTTATTGCTAAGTGGTTGG - Intergenic
992058005 5:73011997-73012019 TGTTTTTTCTAATAAGTAGAAGG + Intronic
992074537 5:73178748-73178770 TTTTTTTTTTAACAAATGGAAGG + Intergenic
992705917 5:79392197-79392219 TGTTTTTTTAAATAAGTAGAAGG - Intronic
992943140 5:81782805-81782827 TTTTTTTTTTAATAAGTAGAAGG + Intergenic
993160386 5:84282829-84282851 TCTTTTTTTTACTTTGAGGAAGG + Intronic
993856069 5:93077047-93077069 TCTTTTCATTACTAAGTAGATGG - Intergenic
994475263 5:100260398-100260420 TTCTTTTTTTGGTAAGGGGAGGG + Intergenic
994678726 5:102859144-102859166 ACATTTTTTTTGTAAGTAGAAGG - Intronic
994957240 5:106547699-106547721 TCATATTTTTATTAAGTTGATGG + Intergenic
995496200 5:112747008-112747030 TCTTTCTTTTATTAAGAGAAGGG + Intronic
995957207 5:117792072-117792094 TTTCTTCTTTAGTAAGTGAATGG + Intergenic
996436647 5:123440735-123440757 CTTTTTTTTTAATAAGTAGAGGG + Intergenic
996504118 5:124250092-124250114 CCTTTTCTTTAATAAGTTGAAGG + Intergenic
996704498 5:126483632-126483654 TCTTTTTTTTTTTAAGGGGGTGG - Intronic
996946208 5:129072099-129072121 TATTTTGTTTGGAAAGTGGAAGG + Intergenic
996948016 5:129093933-129093955 TCTGTTTTTAAGTAAGTAAAAGG - Intergenic
998358467 5:141562402-141562424 TCCTTGTTTTGGTAAGAGGAAGG + Intronic
998463387 5:142325283-142325305 TTTTTTTTTTAATGAATGGAGGG + Intronic
998541361 5:142984910-142984932 TTTTTTTTTTAATAAGTAGAAGG - Intronic
998892072 5:146757028-146757050 TCTTGTTTTTAGGATGTGAAAGG + Intronic
999121797 5:149215513-149215535 TCTTTTTTTTTTTATGTGGGGGG - Intronic
999215223 5:149928070-149928092 TTTCTTTTTTAATAAGTAGAAGG + Intronic
1000106810 5:158067699-158067721 TCTTTTTTTTTGTAGATAGAAGG - Intergenic
1000745248 5:165025005-165025027 TTATTTTTTTAGGAAGTAGAGGG + Intergenic
1000752687 5:165116129-165116151 TATTTTTTTTAGTGACTGGTGGG + Intergenic
1000989794 5:167900099-167900121 TTTTTTTTTTAGTGGGTTGAGGG - Intronic
1001060877 5:168487359-168487381 TTTTTTTTTTTGTAGGGGGACGG - Intronic
1001631569 5:173179360-173179382 CATTTTTTTTTTTAAGTGGAAGG + Intergenic
1002807196 6:588650-588672 TCTTTTCATTAGAAAGTGAAGGG - Intronic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003702611 6:8485889-8485911 TCTTTTATTTAAAAAGTGAATGG + Intergenic
1003714751 6:8633908-8633930 TTTTGTTTTCAGTTAGTGGAGGG + Intergenic
1004009709 6:11670757-11670779 GCTTTTTTTTAATAAATGGAAGG - Intergenic
1004100785 6:12608843-12608865 TCTTTGGTTGAGAAAGTGGAAGG - Intergenic
1004192832 6:13479050-13479072 TTTTTTTTTTGGTAAAGGGATGG - Intronic
1004507186 6:16256339-16256361 TTTTTTTTTTAGTAGATGCAGGG - Intronic
1004591007 6:17051665-17051687 TATTTTTTTTAGTAAATAGAAGG - Intergenic
1004658236 6:17685836-17685858 TTTTTTTTAATGTAAGTGGAAGG - Intronic
1004948922 6:20646380-20646402 TTTTTTTTTAAATAAGTAGAAGG + Intronic
1004975652 6:20963301-20963323 TCTTTTTTTTTTTTAGTGGAAGG - Intronic
1004989610 6:21122815-21122837 TTTTTTTTTTGGTAGGGGGAGGG + Intronic
1005826737 6:29636525-29636547 TCTTTTTTTTGGTGGGGGGACGG + Intergenic
1006741486 6:36312264-36312286 TTGTTTTTTTAGGAAGGGGATGG - Intergenic
1006754620 6:36404641-36404663 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1007028654 6:38605354-38605376 ACTAGTTCTTAGTAAGTGGATGG + Intronic
1007141333 6:39577619-39577641 TCTCTCTTTTAATAAATGGATGG - Intronic
1008533453 6:52487012-52487034 TTTTTTTTTTTTTAAGTGAAGGG + Intronic
1008593889 6:53021784-53021806 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1008822895 6:55655229-55655251 TATTTTCTCTAGTAAGTAGAAGG - Intergenic
1008920566 6:56840252-56840274 TATTTTTTTTCTTAAGTGTAAGG - Intronic
1009475747 6:64090057-64090079 TGTTTTATTTAGTAAGAGAAAGG - Intronic
1010145976 6:72669917-72669939 TTTTTTTTTTGGAATGTGGATGG + Intronic
1010364124 6:75030143-75030165 TTTTTTTTTTAATAATAGGAGGG - Intergenic
1010431411 6:75782409-75782431 TCTTTTTTTTTGGAAGGGGCAGG + Intronic
1010793947 6:80097708-80097730 TCTTTTTTTTAATGACTAGAGGG + Intergenic
1010794705 6:80105872-80105894 TTTTTTTTTTAGTAAATTCATGG + Intergenic
1011521110 6:88207920-88207942 ACATTTTTTTAATAAGTAGAAGG + Intergenic
1011733598 6:90291539-90291561 TCTTTTTTTTTGTCAGTTCAGGG - Intronic
1011803480 6:91045275-91045297 ATTTTTTTTCAGTGAGTGGATGG + Intergenic
1011922871 6:92603427-92603449 TTTTTTTTTTGGTATGGGGAAGG - Intergenic
1011982088 6:93391826-93391848 TCTATTTTTAGGTAATTGGAAGG - Intronic
1011995512 6:93582008-93582030 TCTTTTTTCTTTTAAGTGGGCGG + Intergenic
1012609219 6:101194806-101194828 TTTTGTTTTTAATAAGTAGAAGG + Intergenic
1013060467 6:106629284-106629306 CCTTTTTTTTTTAAAGTGGAGGG - Exonic
1013178373 6:107697044-107697066 TCTTTGGTTTTGTAAGTTGATGG - Intergenic
1013360091 6:109385829-109385851 TTTTTTTTTAATTAAGTGCAGGG - Intergenic
1013811598 6:114050642-114050664 ATTTTTTTTTAATAAGTAGAAGG - Intergenic
1013905804 6:115217772-115217794 TCTTTTTTTTGGTATTTGTATGG + Intergenic
1014093824 6:117437750-117437772 TTTTTTTTTTAATAAGTAGAAGG - Intronic
1014286072 6:119499661-119499683 TCTTTTTATTACTAAGTTGTAGG + Intergenic
1014393080 6:120889319-120889341 TTTTTTTTTCGGTACGTGGATGG - Intergenic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1015101070 6:129481375-129481397 TCATTCTTTTGGGAAGTGGAGGG + Exonic
1016544923 6:145210726-145210748 ACTTTTTTTGAGTAAATAGATGG - Intergenic
1016635843 6:146289101-146289123 CTTTTTTTTTAGTATGTAGAAGG - Intronic
1016821072 6:148347031-148347053 TCCTTTTTTTAGGTAGGGGAGGG + Intronic
1016823827 6:148370085-148370107 TTTTCTCTTTTGTAAGTGGAAGG + Intronic
1016999181 6:149983982-149984004 TTTTTTTTTTTTTGAGTGGAAGG + Intergenic
1016999206 6:149984134-149984156 TTTTTTTTTTTTTGAGTGGAAGG + Intergenic
1016999226 6:149984288-149984310 TCTTTTGTTTTTTGAGTGGAAGG + Intergenic
1016999231 6:149984327-149984349 TTTTTTTTTTTTTGAGTGGAAGG + Intergenic
1017354077 6:153481650-153481672 TCTTTTTTTTGGTGGGGGGAAGG + Intergenic
1017373574 6:153740907-153740929 TCTTTTTTTTAGAAAAAGTAAGG + Intergenic
1017566807 6:155695801-155695823 TCATTTGTTTTGTAAGTGGCGGG + Intergenic
1017593488 6:156003034-156003056 TCTTTTTCTTAGTCTGTGTAAGG + Intergenic
1019193123 6:170265603-170265625 TTTTTTTTTTAATAAATAGAAGG + Intergenic
1020724651 7:11796333-11796355 CCTTTTTTTTTCAAAGTGGATGG - Intronic
1020740809 7:12014754-12014776 TTTTTTTTGTAATAAGTAGAAGG + Intergenic
1021047087 7:15936715-15936737 TACATTTTTTAGTAGGTGGAGGG + Intergenic
1021436324 7:20620531-20620553 TTTTTTTTATAGTAAGTTGTAGG - Intronic
1021615149 7:22495944-22495966 GCTCTTTTTTTGTAAGTAGAAGG - Intronic
1021696534 7:23281737-23281759 TTTTTTTTTAAATAAGTAGAAGG - Intergenic
1021755829 7:23851170-23851192 TCTTCATTTTAATAATTGGAGGG - Intergenic
1021812945 7:24421378-24421400 TCTTTTTTTTCTTAAGGGAATGG + Intergenic
1022084424 7:27052724-27052746 TACTTTTTTTAGAAAATGGAAGG + Intergenic
1022587345 7:31626920-31626942 GCTTTCTTCTAGAAAGTGGATGG + Intronic
1022777113 7:33538359-33538381 TCTTTATTGTATTAAGTGGATGG + Intronic
1022940048 7:35226850-35226872 TTTTTTTTTTGATAAGTAGAAGG - Intronic
1023105346 7:36758481-36758503 TATTTTTTTTAGTAAGAGACAGG - Intergenic
1023666260 7:42526521-42526543 CCATTTTTTTTGTAAGGGGAGGG + Intergenic
1024597480 7:50952208-50952230 TTTTTTTTTTTGCAAGTGAAAGG + Intergenic
1024784838 7:52895473-52895495 TTTTGTTTTTAGTAAGTAGAAGG - Intergenic
1025876813 7:65488674-65488696 TCTTTTTTTTATTTAGTAGGTGG - Intergenic
1026593372 7:71714685-71714707 TTTTTTTTTTAGTAAGAGACGGG + Intergenic
1027026968 7:74859832-74859854 TCTTTTTTTTTTTAAGAGGCAGG - Intergenic
1027060784 7:75084278-75084300 TCTTTTTTTTTTTAAGAGGCAGG + Intergenic
1027824183 7:83089641-83089663 TCTTCTTTCAAGTAAGTGGAAGG - Intronic
1027877015 7:83783720-83783742 TGTTTTTATTTTTAAGTGGAAGG + Intergenic
1027962180 7:84960034-84960056 TCTTCTTTTTAGTAACATGAGGG - Intergenic
1028377347 7:90158679-90158701 GCTCTTTTTTTGTAAGTAGAAGG + Intronic
1028617064 7:92780414-92780436 TCTTTTGTTTTGCAAGTGTAAGG - Intronic
1028681738 7:93542965-93542987 TTTTTTTTTAAGTAAGTAGAAGG + Intronic
1029142643 7:98422458-98422480 TATTTTTTTTAGTAAGTGGATGG - Intergenic
1029613388 7:101640252-101640274 TTCTTTTTTTAATAAGTAGAAGG + Intergenic
1029872160 7:103706212-103706234 TTTTTTTTTTAACAAGTGAAAGG - Intronic
1030031794 7:105376537-105376559 TTTTTTTTTTGGTGAGGGGAGGG + Intronic
1030218550 7:107073353-107073375 TTTTTATTTTTGTAAGTGAAAGG + Intronic
1030284359 7:107810404-107810426 TCTTTTTTTTGATAAGTGTATGG - Intergenic
1030587730 7:111441708-111441730 TTTTTTTTTTAACAAGTTGAAGG - Intronic
1030934357 7:115566529-115566551 TCTTATTTTTAGTAAATGCCAGG - Intergenic
1031108077 7:117570180-117570202 TTTTTTTTTAAGTAAGGAGATGG - Intronic
1031743994 7:125469987-125470009 TCTTTTATTTTTTAAGTAGAGGG - Intergenic
1031796525 7:126182032-126182054 TTTTTTTTTTAGTTATTTGAAGG + Intergenic
1032099329 7:128960324-128960346 TTTTTTTTTTTGTAAGTAGAAGG - Intronic
1032650306 7:133870930-133870952 TCTATTCTCAAGTAAGTGGATGG - Intronic
1032674125 7:134112840-134112862 TTTTTTTTTTGGTATGGGGAGGG - Intergenic
1032837337 7:135686374-135686396 TTTTTTTTTAATTAAGAGGAGGG + Intronic
1032977835 7:137245597-137245619 TTTTTTTTTTACTAAGAAGAAGG - Intronic
1033713091 7:143969645-143969667 TTTTATTTTTAGTAAATGCAGGG - Intergenic
1033980134 7:147154098-147154120 TCTTTTTTTTTGTGGGGGGAGGG - Intronic
1034096356 7:148411570-148411592 TCTTTTTTATAGTTTGTGGTTGG + Intronic
1036535161 8:9642983-9643005 TACTTTTTTAAGTCAGTGGAAGG + Intronic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1037511555 8:19588196-19588218 TCTTTTTTTTGCTGAGGGGATGG - Intronic
1037814779 8:22106407-22106429 TTTTTTTTTTGCTAAGTGGCCGG - Intergenic
1038124072 8:24651727-24651749 TTTTTTTTTTTGTAAGTAGTGGG - Intergenic
1038205762 8:25463592-25463614 TTTTTTTTTTAATCAGTAGAAGG - Intronic
1038775991 8:30531128-30531150 TTTTTTTTTTAATTAGGGGACGG - Intronic
1038787410 8:30631626-30631648 TCTTATTTTTTGTCAGTAGAAGG - Intronic
1039077793 8:33708221-33708243 TCTTTTTTTTTGTAAGAGACAGG - Intergenic
1039536784 8:38323453-38323475 TCCTTTTTTTCTTAAGTGGAAGG - Intronic
1039718587 8:40137672-40137694 ACTTTATTTTATTAAGTAGAAGG + Intergenic
1039949116 8:42153663-42153685 TTTTTTTTTTTGGAGGTGGAGGG + Intronic
1040922596 8:52639602-52639624 TCTTTTTATTTGTAAGTATATGG - Intronic
1041044520 8:53878427-53878449 TTTTTCTTTTGGAAAGTGGAGGG - Intronic
1041275523 8:56153819-56153841 TTTTTTTTTTTGCAAATGGATGG - Intergenic
1041621146 8:59970837-59970859 TTTTTTTTTTTGTCAGTAGAAGG - Intergenic
1041751278 8:61263607-61263629 TCTTTTTTTGATGAAGTGAATGG + Intronic
1041830955 8:62152719-62152741 TATTTTTTTTTATAAGTAGAAGG - Intergenic
1041995912 8:64057775-64057797 TACTTTTTTTAGTAAGTAGAAGG - Intergenic
1042041008 8:64588442-64588464 TCATTTTTTTATTAGGAGGATGG + Intronic
1042294361 8:67203568-67203590 TCTTCTTTTTAGTAACTGGCTGG + Intronic
1042366961 8:67948174-67948196 ACTTTTTTTTAGGAAGTGATGGG + Intergenic
1042383474 8:68147068-68147090 CATTTTTTTTAGAATGTGGAGGG - Intronic
1042744347 8:72090654-72090676 TCTTTTATTCAGTAGGAGGATGG - Intronic
1042849962 8:73207029-73207051 TTTTGTTTTTAATAAGTAGAAGG - Intergenic
1043039394 8:75242099-75242121 ACTTTTTTTTAATAAGTAGAAGG - Intergenic
1043307234 8:78810316-78810338 CTTTTTTTTTAATAAGTAGAAGG + Intergenic
1043669889 8:82870544-82870566 TCTTTGTTTTTATAAGTAGAAGG - Intergenic
1043794294 8:84516276-84516298 TATTTTTCTTATTAAGTGCATGG - Intronic
1044142713 8:88674702-88674724 TCTTCTTTATAGTAATTGGGAGG + Intergenic
1044276632 8:90307976-90307998 TTTTTTTTTTAATGTGTGGAAGG - Intergenic
1044740323 8:95319885-95319907 TCTTTTTTTTGGTGGGGGGATGG - Intergenic
1044760538 8:95513267-95513289 TCTTTTTTCTAGGAAATGTAAGG + Intergenic
1045355459 8:101384656-101384678 TTTTTTTTTTAATAAATTGAAGG - Intergenic
1045510911 8:102811084-102811106 TTTTTTTTTTTTTAAGTGGATGG - Intergenic
1045893909 8:107191231-107191253 TCTGTTCTTGAGTAAGTGTAAGG - Intergenic
1046663122 8:116970369-116970391 ACATTTTTTTAATAAGTAGAAGG + Intronic
1047130112 8:122009338-122009360 TCTTTTTTTCTGTTAGGGGATGG + Intergenic
1047174722 8:122529469-122529491 TCATTTATTTAGCAAGTGAAGGG + Intergenic
1048394967 8:134005582-134005604 TTTTTTTTTTTTCAAGTGGATGG + Intergenic
1049394349 8:142392323-142392345 ACTTTTTTTTAATAAGTAAAAGG + Intronic
1050163579 9:2742280-2742302 ACTTTTTTTTCTAAAGTGGAAGG - Intronic
1050286006 9:4102786-4102808 TTTTTTTCGTAGTCAGTGGATGG + Intronic
1050417420 9:5432319-5432341 TCTCTTTTTTTGTGAGGGGAAGG + Intronic
1050484474 9:6119107-6119129 TCTTTGTTTTTTTAAGAGGAAGG - Intergenic
1050820525 9:9873397-9873419 TATTTTTTTTTGTAAATGGATGG - Intronic
1051168429 9:14291949-14291971 TCTCTTTTTTTGTGTGTGGATGG - Intronic
1051172071 9:14328939-14328961 GCTTTTTTTGAAAAAGTGGAAGG + Intronic
1051221191 9:14850203-14850225 TCTGTTTTGTAGTTAGTGGGAGG - Intronic
1052130667 9:24842683-24842705 TCTTTTTTTTTGCATGTGGATGG + Intergenic
1052479663 9:29007705-29007727 TTTTTATTTTAGTAGCTGGATGG + Intergenic
1052666263 9:31499022-31499044 AGTTTTTTTTAGTAAATAGAGGG - Intergenic
1052668514 9:31524934-31524956 TTTTTTTTTTTGTTAATGGATGG - Intergenic
1052856780 9:33412117-33412139 TATTTCTTTGAGTAAGTGGCTGG + Intergenic
1053302855 9:36964104-36964126 TCTATTTTTTAGTAGGGGCAGGG - Intronic
1053367405 9:37532949-37532971 CCTTTGTTTTATAAAGTGGAAGG - Intronic
1053640547 9:40072088-40072110 ACTTTTTTTTCTGAAGTGGATGG - Intergenic
1054544203 9:66304539-66304561 ACTTTTTTTTCTGAAGTGGATGG + Intergenic
1054834525 9:69662372-69662394 ACTTGTTTTTAGTCACTGGATGG + Intronic
1054945383 9:70790783-70790805 TTTTTTTCTTAGTAAGTTTAAGG + Intronic
1056096018 9:83254399-83254421 TTTTTGTTTTTGTAAGTGAAAGG - Intronic
1056242528 9:84662578-84662600 TTCTTTTTTTAGTAAGTAGAAGG + Intergenic
1056871142 9:90280555-90280577 TCTTTTTTTAAGTAAGTGTTTGG - Intergenic
1057775619 9:98006349-98006371 TGCTTTTTTTAGTCAGTGCATGG + Intronic
1058239450 9:102538413-102538435 TTTTTTTTTTAATATTTGGAAGG - Intergenic
1058281239 9:103117550-103117572 TTTTTTTTTTAACAAGTAGAAGG - Intergenic
1058297200 9:103324087-103324109 TTTTTTTTTTAATAAGAGAAAGG + Intergenic
1058601451 9:106675079-106675101 TCTTTTTCTTTGCAAATGGAAGG - Intergenic
1058622391 9:106897484-106897506 TTTTTTTTTTAGTAATTCCATGG + Intronic
1059174099 9:112153498-112153520 AGTTTTTTTTAATAAGTAGAAGG + Intronic
1059485108 9:114620915-114620937 TGTTTTTTTTTGGAAGTGGTGGG - Intronic
1059517891 9:114912868-114912890 TTTTCTTTTTAGCAAGTGGAGGG + Intronic
1059597065 9:115732457-115732479 TTTTTTTTTTAGAAAGGGCAGGG - Intergenic
1060011568 9:120047834-120047856 ACTTTATTTTAATAAGTAGAAGG + Intergenic
1060455495 9:123790655-123790677 TCTTTGCTTTAGTTAATGGATGG - Intronic
1185637245 X:1561738-1561760 TTTTTTTTTTTTTAAGTGTATGG - Intergenic
1186349681 X:8729700-8729722 TTTTTTTTTTAATAATTAGAAGG - Intronic
1186567329 X:10677437-10677459 TCTTCTTTTTAAAAACTGGAGGG - Intronic
1186577082 X:10778039-10778061 TTTTTTCTTTAATAAGTAGAAGG + Intronic
1186611383 X:11140884-11140906 TCTGCTTTTTAAGAAGTGGAGGG - Intronic
1186814611 X:13224227-13224249 TTTTTTTTTTTTCAAGTGGATGG + Intergenic
1187802443 X:23079437-23079459 TTTTTTTTTTAGTTAATGAAAGG - Intergenic
1187934493 X:24322436-24322458 TTTTTTTTTTAATGAGTGGGTGG + Intergenic
1188205544 X:27352858-27352880 TCTTTTCCTTTGTAATTGGAGGG - Intergenic
1188721929 X:33532799-33532821 TCTCCTTTTTATTGAGTGGATGG - Intergenic
1188901919 X:35743733-35743755 TCTTTCTTTGAATGAGTGGAAGG + Intergenic
1189241303 X:39526618-39526640 TCTTTTATTATGTAAATGGAAGG + Intergenic
1189646068 X:43133735-43133757 TCTCTTTTTTTGCAAGGGGAAGG - Intergenic
1189707589 X:43774534-43774556 TCACTTTCTTAGCAAGTGGATGG - Intronic
1189747569 X:44185541-44185563 TCTTTTTTTTTTTAAGAGGCAGG + Intronic
1190788990 X:53682560-53682582 GCTGTTTTCTAGTAAATGGAAGG + Intronic
1191056581 X:56247828-56247850 ACTTTTTTTTAGTAAGTAGAAGG + Intronic
1192270968 X:69578980-69579002 TTTTTTTTTTGGCAATTGGAAGG - Intergenic
1193805966 X:85994825-85994847 TCTTTATTTTTGAAAGAGGAAGG + Intronic
1193826870 X:86237264-86237286 ACTTTTTTTTAATAAGTAGAAGG + Intronic
1194365945 X:93013772-93013794 TATTTTGTTTAATTAGTGGAAGG - Intergenic
1194675911 X:96793470-96793492 TCTGTTGTTTAAAAAGTGGAAGG - Intronic
1194779668 X:98009692-98009714 TCTGTGTTTTAATAAGTTGAAGG + Intergenic
1195905557 X:109840793-109840815 TTTTTTTTTTTTTAAATGGATGG + Intergenic
1196082402 X:111647532-111647554 ACTATTTTTTAATTAGTGGAAGG + Intergenic
1196087843 X:111705652-111705674 TCCTTTTTTTTGCATGTGGATGG + Intronic
1196394139 X:115241343-115241365 TCTTTTCTTTTGTAAATGGGGGG - Intergenic
1196657951 X:118239485-118239507 TCTTTTGTTTACTCAGTGAAAGG - Intergenic
1196702065 X:118680418-118680440 TTTTTATTTTATTCAGTGGAAGG - Intronic
1196864809 X:120061266-120061288 TATTTTTTTTAGTGATTGGCTGG - Intergenic
1196878292 X:120175065-120175087 TATTTTTTTTAGTGATTGGCTGG + Intergenic
1196881418 X:120201190-120201212 TTTGTTTTTTAGAAAGTGGGTGG - Intergenic
1196898074 X:120357682-120357704 TCTGTTTTTTTGGGAGTGGAGGG - Intergenic
1197047246 X:122012325-122012347 TTTTTTTTTAAATAAGTAGAAGG - Intergenic
1197063479 X:122211562-122211584 TCTTTTCTCTGGTAACTGGATGG - Intergenic
1197119418 X:122872576-122872598 TCTTTTTTTAAGTAAGAAGAAGG - Intergenic
1197347501 X:125342120-125342142 TCTTTTTTTTTGTTGGTGGGGGG - Intergenic
1197690308 X:129493454-129493476 TCTTTTTTAAAATAAATGGATGG + Intronic
1197717967 X:129723570-129723592 TCTTTTATTTTATCAGTGGATGG - Intergenic
1198235631 X:134733876-134733898 TCTTTTTTTTTCTAAGGGAAGGG - Intronic
1198432650 X:136582991-136583013 TGTTTTTTTTAATAAGTAGAAGG - Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199349470 X:146784028-146784050 ACTGTTATTTATTAAGTGGATGG - Intergenic
1199467107 X:148150720-148150742 TCTTTTATTGAGGAAGAGGAAGG + Intergenic
1199833915 X:151569836-151569858 CCTTTCTTTCAGGAAGTGGAAGG + Intronic
1200423669 Y:2999106-2999128 TCTTTTTTTTAGTTAGCAGCAGG + Intergenic
1200674167 Y:6130027-6130049 TATTTTGTTTAATTAGTGGAAGG - Intergenic
1201417744 Y:13764212-13764234 TCTCTTTTTTTGGAGGTGGAGGG - Intergenic
1201619010 Y:15934284-15934306 TATTTTTTTAAGGATGTGGAGGG + Intergenic
1201849196 Y:18459007-18459029 TTTTTTTTTTGGTAAGTTGGTGG - Intergenic
1201884122 Y:18861368-18861390 TTTTTTTTTTGGTAAGTTGGTGG + Intergenic
1201911981 Y:19142100-19142122 ACTTTTATTTGGTGAGTGGATGG - Intergenic