ID: 1129051123

View in Genome Browser
Species Human (GRCh38)
Location 15:72782927-72782949
Sequence GGGCGTGTTCAATGCGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129051123 Original CRISPR GGGCGTGTTCAATGCGTGGA AGG Intronic
903318451 1:22526953-22526975 GGGCGTGGCCACTGGGTGGAGGG - Exonic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
911088553 1:93999753-93999775 GGGAGTGTTCCCTGTGTGGAGGG - Intronic
912438613 1:109680685-109680707 GGGGGTGTTAAATGCAGGGAGGG + Intronic
912441134 1:109699130-109699152 GGGGGTGTTAAATGCAGGGAGGG + Intronic
1069157291 10:65046903-65046925 GGGTGTGTTCAGTCCGTTGATGG + Intergenic
1070671839 10:78382959-78382981 TGGCGTGTTCAGTGGGTGGCTGG - Intergenic
1076774654 10:132688044-132688066 GGGCGTGTGCAGTGCATGGTGGG - Intronic
1113948109 13:114056214-114056236 GTGCGTGTCCAATGCGTGTCTGG + Intronic
1119761041 14:77152058-77152080 GGGCATGTTCATAGAGTGGATGG + Intronic
1129051123 15:72782927-72782949 GGGCGTGTTCAATGCGTGGAAGG + Intronic
1133775741 16:8893966-8893988 TGGTGTGTTCAAGGCGAGGACGG - Exonic
1160392869 18:78548108-78548130 GGGCGTGGTCAAGGCCCGGAAGG - Intergenic
1160826375 19:1082323-1082345 GGGCGTGTTCAGCGCTTGGCAGG + Intronic
925730252 2:6915017-6915039 GAGCTTGTTCAATGAGTGAAGGG + Intergenic
928725221 2:34164857-34164879 GGACATGTTCAATGAGTAGAAGG - Intergenic
935807279 2:106761526-106761548 GGGTCTGTTCAATGGGTTGAGGG - Intergenic
1168883406 20:1226031-1226053 GGGCGTCTGCAATGCGCGGCAGG - Intergenic
1183605401 22:38864753-38864775 TGGCGTGTTCCAGGCGTGGCTGG - Exonic
1184828377 22:46968559-46968581 GGGCGTCCTCACTGCGTGGCCGG + Intronic
1184828387 22:46968597-46968619 GGGCGTCCTCACTGCGTGGCCGG + Intronic
952888657 3:38027001-38027023 GGGGGTGTTCAGTGAGGGGAGGG + Intronic
958169307 3:89918095-89918117 GGGCATGTTCAATTGGTGGAGGG + Intergenic
961567894 3:127776535-127776557 GGGCATCCTCAATGCCTGGAGGG - Intronic
965375225 3:167914867-167914889 GGGAGTGTTCCATGGGTGTATGG - Intergenic
965377500 3:167943538-167943560 GGTCTTGTCCAATGTGTGGAAGG - Intergenic
969239454 4:5889131-5889153 GGGCTGGTTCAATGCTAGGATGG - Intronic
972644085 4:40951720-40951742 AGCCGTGTTCACTGCATGGATGG + Intronic
978913522 4:114095358-114095380 GGGTGTGTTCAATGCATACAGGG + Intergenic
985588453 5:752778-752800 GGGCGTGTCCACTGCCTGGAGGG - Intronic
985603125 5:845233-845255 GGGCGTGTCCGCTGCCTGGAGGG - Intronic
988144402 5:27287157-27287179 GGGCTTGTTCAATTAGTTGATGG + Intergenic
995368099 5:111386527-111386549 GCGCGTGTTAACTGCCTGGATGG + Intronic
1008676273 6:53822588-53822610 GGCCCTGATAAATGCGTGGACGG + Intronic
1009781531 6:68277852-68277874 GGGCCTGTTGAATGGGTGAAAGG - Intergenic
1013245520 6:108283543-108283565 GGGGGTGTCCAGTGGGTGGATGG + Intergenic
1014880287 6:126715792-126715814 GGGGGTGTTCAATGAGTGCTTGG - Intergenic
1023017293 7:35981081-35981103 AGTCCTGTTCAATGCGTGAAGGG + Intergenic
1023457441 7:40355896-40355918 GAGCATGTTCATTGCCTGGAAGG + Intronic
1038038625 8:23706253-23706275 GGGCGTGATCCATGGGTGCATGG - Intronic
1051909595 9:22138229-22138251 TGGCATGTTCAAGGCTTGGAAGG + Intergenic
1056658817 9:88529924-88529946 GGGTCTGTTCAATGAGTAGAGGG - Intergenic
1187261092 X:17686001-17686023 GGGAATGTTCCATGGGTGGATGG + Intronic