ID: 1129051228

View in Genome Browser
Species Human (GRCh38)
Location 15:72783543-72783565
Sequence GGTCCCGGGGGCGCAGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 419}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129051220_1129051228 -8 Left 1129051220 15:72783528-72783550 CCCTCGGGGGAGACGGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG 0: 1
1: 0
2: 1
3: 37
4: 419
1129051216_1129051228 0 Left 1129051216 15:72783520-72783542 CCAACCGGCCCTCGGGGGAGACG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG 0: 1
1: 0
2: 1
3: 37
4: 419
1129051215_1129051228 3 Left 1129051215 15:72783517-72783539 CCGCCAACCGGCCCTCGGGGGAG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG 0: 1
1: 0
2: 1
3: 37
4: 419
1129051219_1129051228 -4 Left 1129051219 15:72783524-72783546 CCGGCCCTCGGGGGAGACGGGTC 0: 1
1: 0
2: 1
3: 10
4: 81
Right 1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG 0: 1
1: 0
2: 1
3: 37
4: 419
1129051206_1129051228 29 Left 1129051206 15:72783491-72783513 CCGCACGATAAGCGCGTCCCAGG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG 0: 1
1: 0
2: 1
3: 37
4: 419
1129051222_1129051228 -9 Left 1129051222 15:72783529-72783551 CCTCGGGGGAGACGGGTCCCGGG 0: 1
1: 1
2: 0
3: 19
4: 149
Right 1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG 0: 1
1: 0
2: 1
3: 37
4: 419
1129051210_1129051228 11 Left 1129051210 15:72783509-72783531 CCAGGCTGCCGCCAACCGGCCCT 0: 1
1: 0
2: 2
3: 24
4: 177
Right 1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG 0: 1
1: 0
2: 1
3: 37
4: 419
1129051209_1129051228 12 Left 1129051209 15:72783508-72783530 CCCAGGCTGCCGCCAACCGGCCC 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG 0: 1
1: 0
2: 1
3: 37
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129051228 Original CRISPR GGTCCCGGGGGCGCAGGCGC GGG Exonic
900126684 1:1071867-1071889 GGGGCCGGGGGGGCAGGGGCAGG + Exonic
900152046 1:1183015-1183037 GTTCCGGGGGCCTCAGGCGCGGG + Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900349760 1:2228718-2228740 GGGCCCGGGCGCGCGGGAGCGGG + Exonic
900513209 1:3069877-3069899 GGCTCCGCGGGCGCAGGGGCAGG + Intronic
900534611 1:3170690-3170712 GGGCCCGGGGGAGCAGGGGAAGG + Intronic
900591283 1:3461297-3461319 GGTCACTGCGGCGCAGACGCAGG + Intronic
900606125 1:3524317-3524339 GGTGCCGGGGGCCCAGACCCAGG + Intronic
900648158 1:3718245-3718267 GGTCCTGGGGGCCCAGGCGCGGG - Intronic
900678951 1:3905597-3905619 GGCCCCAGGGGCGCAGGCATTGG - Intergenic
901109939 1:6785887-6785909 GGTCCGGGTGGGGGAGGCGCCGG - Intronic
901232109 1:7647090-7647112 GGTCCCTGGAGAGCAGGTGCTGG - Intronic
901401692 1:9019187-9019209 GGTACCTGGGGCCCAGGCTCCGG - Exonic
902533366 1:17104838-17104860 GGTCCCGGGCCCGCAGAGGCTGG + Intronic
902931433 1:19734430-19734452 GGACCCGGGGGCACTGGTGCTGG - Intronic
903468390 1:23568171-23568193 GGTCCCGGACGCGCAGCTGCGGG + Intergenic
903813228 1:26046260-26046282 GGCCCCATGGGCGCAGGCACAGG - Intergenic
903860573 1:26361956-26361978 GGGCCCCGGAGTGCAGGCGCAGG + Exonic
904617258 1:31756533-31756555 GGTCCAGGGGCAGCAGGCGGGGG + Exonic
904684655 1:32251384-32251406 GGTATTGGGGGCGCAGGCGCCGG + Intronic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
906476669 1:46173912-46173934 GGTCCCAGGGCCGCAGGGGCAGG + Intronic
911072924 1:93846739-93846761 GGCCCCGGGCGCGCGGGCTCGGG + Intronic
914490005 1:148146133-148146155 GGGCCCGGGGGCGCGGGCCGGGG + Intronic
915513654 1:156400674-156400696 GGTGCGGGGGGCGCGGGGGCTGG + Intergenic
920525632 1:206663949-206663971 GGTGCCGTGGGAGCAGGTGCTGG + Intronic
922455228 1:225768839-225768861 GGGCCCGGGAGGGCAGGCACTGG - Intergenic
922960857 1:229644595-229644617 GGTGCCAGGGGGGCAGGCCCTGG + Intronic
923506169 1:234608689-234608711 GGGCCCCGGTGCGCAGGCGGCGG + Exonic
924775317 1:247111794-247111816 GGTCCTGCAGGCGGAGGCGCCGG + Exonic
924948056 1:248858952-248858974 GGCCCGGGAGGCGCAGGCGCAGG - Intronic
1064981869 10:21173841-21173863 GTTCCCGGGGGCGGCGGCGGCGG + Intronic
1064981932 10:21174030-21174052 GCTCTCGGGCTCGCAGGCGCTGG + Intronic
1066370277 10:34814454-34814476 GGCCCCGGGGGCACAGGCCGGGG - Intronic
1067096543 10:43305061-43305083 GATCCCGGGGGCGGGGGCGGGGG - Intergenic
1068827165 10:61453108-61453130 GGTCCTGGGGGCGCAGGCAAGGG - Exonic
1069544519 10:69318913-69318935 GGTCGCGGGGCGGCAGGCGTGGG - Intronic
1069962725 10:72087935-72087957 GGTCCCAGGGCCGCCGGCCCGGG + Intronic
1071525283 10:86354716-86354738 GGTCCCGGGGAGGCAGGGGCAGG + Intronic
1071618199 10:87095032-87095054 CGTCGGGGGCGCGCAGGCGCGGG + Intronic
1075645255 10:124092583-124092605 GGTCCCACGGGCTTAGGCGCGGG + Intronic
1076218929 10:128717668-128717690 GGTCCCAGAGGCCCAGGCTCAGG + Intergenic
1076785724 10:132748954-132748976 AGTCCCTGGGGCGCAGGCTGGGG - Intronic
1077017480 11:403388-403410 CGTCCCGGTGGCGCAGGCCTTGG + Intronic
1077041921 11:528583-528605 GGTCCTGGGGATGCAGACGCGGG - Intergenic
1077130230 11:968366-968388 GGTCCCGCGGGAGCAGAGGCTGG + Intronic
1077142795 11:1031773-1031795 GGGCCCGGGGGCTCGGGGGCCGG - Intronic
1077417656 11:2432374-2432396 GGCCCCGTGGGGGCAGGGGCTGG - Intergenic
1077419739 11:2444733-2444755 GGGGGCGGGGGCGCAGGCGGGGG + Intronic
1077602025 11:3580876-3580898 GGTCCCGGGGGCGCAGGGTAGGG - Intergenic
1078066319 11:8081447-8081469 GGGCCCGGAGGGGCCGGCGCGGG - Intronic
1078514405 11:12009536-12009558 GATGCCGCGGGCGCAGGGGCAGG - Intronic
1080588335 11:33700505-33700527 GGTGGCGGGGGCGGGGGCGCCGG + Exonic
1081700054 11:45147032-45147054 GGTCCGGACGGCGCCGGCGCGGG + Intronic
1081705780 11:45181230-45181252 GGGCCTGGGGGCGCTGGCGAGGG - Intronic
1083173323 11:60935275-60935297 CATCCTGGGGGAGCAGGCGCTGG + Exonic
1083659782 11:64246712-64246734 CGTCCCGGAGGCGGTGGCGCAGG - Exonic
1083663021 11:64260543-64260565 GGGCCAGGGGGTGCAGGAGCGGG + Intronic
1083882218 11:65554242-65554264 GGTACCGGCGGCTCAGGCCCCGG - Exonic
1083895204 11:65616273-65616295 GGTCCCGGGAGGGGGGGCGCGGG + Exonic
1083970348 11:66070514-66070536 GGTCCCGGAGGCGCCGGGGGCGG + Exonic
1083997220 11:66278415-66278437 GGCCCGGGGGGCGCCAGCGCGGG - Exonic
1084173255 11:67410547-67410569 GGTCCCGAGGGGGCAGACGCAGG - Intronic
1084192196 11:67504358-67504380 GGCCCCGGCGGCGCGGGCGGCGG - Intronic
1084664518 11:70569286-70569308 GGTCCTGGGGGGTCAGGCTCGGG + Intronic
1084946149 11:72639710-72639732 GTTTCCGGCGGAGCAGGCGCTGG - Intronic
1086590506 11:88509274-88509296 GGTGCGGGCTGCGCAGGCGCCGG - Exonic
1086786215 11:90972400-90972422 GGTCCCGGGGACGCCTGCGCGGG + Intergenic
1088644642 11:111908001-111908023 GGCCCCGGGGGAGCAGGAGATGG - Intergenic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1089158905 11:116423116-116423138 GGTCCTGGAGGCGCAGGGGAAGG + Intergenic
1089515785 11:119030610-119030632 GGGGCCGGGGGTGCAGGAGCTGG + Exonic
1089713706 11:120336447-120336469 GGTCCGGGAGGCGGAGGCGGCGG - Intergenic
1089738179 11:120564109-120564131 GGGCCCGGGCGCGCAGGCGGCGG + Intronic
1089773605 11:120820635-120820657 GGTGCCTGGGGCTCAGGCACTGG - Intronic
1090029728 11:123196155-123196177 GAGCCCGGGCGCGCAGGCCCTGG - Intergenic
1090919827 11:131197887-131197909 GGAGCCGGGGACACAGGCGCAGG + Intergenic
1090969376 11:131627034-131627056 GCTCCAGCGGGCTCAGGCGCTGG + Intronic
1091286771 11:134412303-134412325 GGTCCCGCCGGCGCTGGCGCGGG - Intergenic
1092428167 12:8390219-8390241 GGTGCCGGGGGCGCAGGGTAGGG - Intergenic
1092743164 12:11649548-11649570 GGCCGCGGGGGCGCGGGCGGAGG - Intergenic
1093154568 12:15665824-15665846 GTCCCAGGGGGCGCAGGGGCAGG + Exonic
1094703996 12:32896961-32896983 GGGCCCGGGGGCGGGGGCGGGGG + Intergenic
1095812241 12:46383488-46383510 GGTCGCGGGCGCGCAGAGGCGGG - Intergenic
1096077544 12:48814779-48814801 GGTCCCGGGGCCGCAGGGTCCGG - Intronic
1096717415 12:53499680-53499702 CGTCCCGGGGGGCCAGGGGCGGG - Intronic
1097183814 12:57185603-57185625 CATCCCGTGGGCACAGGCGCAGG - Exonic
1097896175 12:64825895-64825917 GGTCCCCAAGGCGCTGGCGCTGG - Intronic
1098425834 12:70365716-70365738 GCTCCCTTGGGCGCAGCCGCTGG + Intergenic
1100329549 12:93571159-93571181 GGTCCCGGGTGCACAGCCTCAGG + Intronic
1101365193 12:104064443-104064465 GGTCACGTGGCCGCGGGCGCCGG - Exonic
1101466800 12:104957971-104957993 GGACCCGGCGGCGGGGGCGCGGG - Intronic
1101679969 12:106955633-106955655 CGTCCAGGGGGCGAAGGGGCGGG + Intergenic
1101870629 12:108562682-108562704 GCTCCCGGGCGGGCAGGCGGGGG - Exonic
1103074212 12:117969104-117969126 GGTCCCTGGCGCGCCGGGGCCGG - Intergenic
1103562091 12:121798115-121798137 GGTGCCATGGGCACAGGCGCTGG + Intronic
1103626654 12:122225555-122225577 GGGGCCGGGGGAGCTGGCGCAGG - Intronic
1103722174 12:122980880-122980902 GGAGCCGGGTGCGCAGGCGTGGG + Exonic
1104443637 12:128815746-128815768 GGTCTCTGGGGCCCAGGCCCAGG + Intronic
1107133346 13:36919727-36919749 GGTCCCGGGGCCCGCGGCGCGGG + Intronic
1112752558 13:102597220-102597242 GGGCCCGGGCGCGGGGGCGCGGG + Intronic
1113473286 13:110561772-110561794 GGGCCCGGGGGCGGGGGCGGGGG - Intergenic
1113541933 13:111115709-111115731 GGACCGGGGGGCGCGGGCGGGGG - Intronic
1113737591 13:112689784-112689806 GCCTCCCGGGGCGCAGGCGCTGG - Intergenic
1113820654 13:113209870-113209892 GGCCCCGGGAGCGGGGGCGCCGG + Intronic
1115028401 14:28767502-28767524 GGTGCCGGGGGCGGCGGCGGCGG - Exonic
1117842091 14:59870556-59870578 GGTCCCAGTGGCTCAGGCACCGG - Exonic
1118385352 14:65251626-65251648 GGTCCCAGGGGCAAAGGAGCAGG - Intergenic
1202905485 14_GL000194v1_random:69046-69068 GGTCCCAGGGGCGCGGCCTCAGG + Intergenic
1124983173 15:34582933-34582955 TGCCCCGGGGCTGCAGGCGCCGG - Intronic
1125508806 15:40282083-40282105 GGTCCCGTGGCCGCGGGCGGCGG + Exonic
1125937523 15:43649327-43649349 GGGGCCGGGGGCGAGGGCGCGGG + Intronic
1125956100 15:43792250-43792272 GCTCCCGGGCGCGAAGGGGCGGG + Intronic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129503215 15:76059820-76059842 GGAGGCGAGGGCGCAGGCGCGGG + Exonic
1130370931 15:83284738-83284760 CGTCCCCGGGGCGCAGGGGGCGG - Intergenic
1132550323 16:551365-551387 CATGCCGGGGGCGCAGGCCCAGG - Exonic
1132594315 16:741209-741231 GGTGCAGGGGGCGCAGGGGTTGG + Intronic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132660366 16:1058335-1058357 GGTCCCAGGGAGGCCGGCGCTGG + Intergenic
1132683564 16:1153321-1153343 CGGGCCGGGGGCGGAGGCGCTGG + Exonic
1132683583 16:1153355-1153377 GGGGCCGGGGGCGGAGGCGCTGG + Exonic
1133127278 16:3655246-3655268 GGTCAGGGGGACGCAGGCGGGGG - Intronic
1136500830 16:30669051-30669073 GGTCCCTGGAGGGCAGGCGTGGG - Exonic
1137267973 16:46884353-46884375 GGGCCGGGCGGCGCGGGCGCCGG + Intergenic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1137731451 16:50693523-50693545 GGTCCCGGCAGAGCAGGGGCGGG + Intergenic
1139465043 16:67149992-67150014 GTGCCCAGGGGCGCAGGCTCGGG - Exonic
1139496933 16:67326766-67326788 GGTCGCGGCGGCGCGCGCGCGGG + Intergenic
1139550107 16:67668207-67668229 GGTACAGCGGCCGCAGGCGCTGG - Exonic
1139603555 16:68001597-68001619 GGGCCCTGGGGTGCAGGAGCTGG + Intronic
1139615443 16:68085751-68085773 GAGCCCGGGGGCGGCGGCGCCGG - Exonic
1140404012 16:74695652-74695674 GGACGCGGTGGCCCAGGCGCCGG + Exonic
1142070773 16:88090441-88090463 TCTCCCGGGGGCACAGGCCCTGG + Intronic
1142114843 16:88351241-88351263 GGTCCCGGGTGCCCAGCTGCGGG + Intergenic
1142120228 16:88383359-88383381 GCCCCCGAGGGCGCAGGAGCGGG - Intergenic
1142271876 16:89094047-89094069 GCTCTCGGGGGCGCGGGCTCCGG + Intronic
1142367546 16:89657948-89657970 GGTAAAGGAGGCGCAGGCGCTGG + Exonic
1142623549 17:1179433-1179455 GGTCTGGGGGGCGCGGGCGGGGG - Intronic
1142623587 17:1179524-1179546 GGTCCGGGGAGCGCGGGCGGGGG - Intronic
1142631622 17:1229567-1229589 GTTCCCCGGGGCGGAGGCGCCGG - Intergenic
1142669193 17:1479702-1479724 GGTCCTGGGGGAGCAGGCCGGGG + Exonic
1142699074 17:1648811-1648833 GTTCCCTGGGGCGCCTGCGCCGG + Exonic
1144340308 17:14304257-14304279 GGTCCAGGGGGCACAGGGCCCGG + Intronic
1144547943 17:16215274-16215296 GCTCCCGGGGCAGCAGCCGCTGG - Intronic
1145190611 17:20840784-20840806 GGGCCCGGGGGCGCGGGCCGGGG + Intronic
1145878287 17:28335930-28335952 GGTCCTGGGGGAAAAGGCGCGGG + Intronic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1146271641 17:31488895-31488917 GGTCCTGGCGGCGCAGTCTCTGG + Intronic
1146322722 17:31859166-31859188 GGCCGCCGGGGCCCAGGCGCAGG - Exonic
1147657370 17:42098494-42098516 GGGCCCGGCGGGGCAGGGGCGGG + Intergenic
1147705377 17:42422049-42422071 GGGCGCGGGGGCGCAGGGTCTGG + Intronic
1148323542 17:46771225-46771247 GGCCCTGGCAGCGCAGGCGCGGG - Intronic
1148633944 17:49132897-49132919 GGTGCTGGGGACGCAGACGCCGG + Intronic
1148807866 17:50273291-50273313 GCTCCCGGGGGCACCCGCGCTGG + Intronic
1148936486 17:51167269-51167291 GGACCCGAGTGGGCAGGCGCAGG - Intronic
1149293336 17:55238340-55238362 GGCCCGGGGCGCGCAGGGGCGGG - Intergenic
1149610581 17:57955497-57955519 GGGCCCGGGGGCGCCGCAGCCGG - Intergenic
1150840374 17:68600997-68601019 GGGCCCCGGGGCGCCGGCGCCGG + Exonic
1151854393 17:76710755-76710777 CGGCTCGGGGGCGCAGGGGCGGG + Exonic
1151854419 17:76710816-76710838 GGTTCCGGGGGCGCGCGGGCAGG + Exonic
1152362434 17:79838967-79838989 GGGCCCGGGGGCCGAGGCGCGGG - Intronic
1152558877 17:81068007-81068029 GGGCCTGGGGGCACAGGTGCCGG + Intronic
1152626533 17:81390291-81390313 GGTCGGGAGGGGGCAGGCGCTGG + Intergenic
1152627201 17:81393279-81393301 GGCCCCGCGGGTGCAGGCGGAGG - Intergenic
1152718495 17:81911224-81911246 GGCCGCGGGGGCGCCGGGGCCGG - Intronic
1156448416 18:37253486-37253508 AGACCCGGAGGCGCAGGCCCAGG + Intronic
1157154884 18:45255805-45255827 GGTGCAGGGGGTGCAGGGGCTGG - Intronic
1160454692 18:78992430-78992452 GGTGCAGGGGCCGCAGGCGGGGG - Exonic
1160680342 19:409221-409243 GGGGGCGGGGGCGCGGGCGCGGG - Intergenic
1160690201 19:458096-458118 GGTCCCGGGGAGGCAGAAGCGGG + Intronic
1160690238 19:458202-458224 GGTTCCGGGGAGGCAGACGCGGG + Intronic
1160996704 19:1885354-1885376 GGGCCCGGGGGCGCGGGCCGGGG - Exonic
1161006870 19:1941440-1941462 GGTGCAGGGGGCGAAGGGGCCGG - Intronic
1161080640 19:2308303-2308325 GGCCACGTGGGCGCAGGTGCGGG + Intronic
1161266410 19:3366685-3366707 GGGCGCGGGGGCGCCGGCGGGGG - Intronic
1161304114 19:3557470-3557492 GGTGCCGTGGGGGCAGGCGCCGG + Exonic
1161471117 19:4457300-4457322 GGTCTCGGGGGCGGGGCCGCAGG - Intronic
1161487641 19:4544265-4544287 GGTCCCGGGGGCCGGGGCGGAGG - Exonic
1161499743 19:4607301-4607323 TCTGCCGTGGGCGCAGGCGCTGG + Intergenic
1161802636 19:6424550-6424572 GGTCCCGGCGGCGGCGGCCCGGG - Exonic
1162128480 19:8511736-8511758 GGTCCGGTGGGGGCAGGGGCGGG + Exonic
1162744757 19:12792129-12792151 GGTGCAGGGGGCGCAGGGGGCGG + Exonic
1162968764 19:14167877-14167899 GGGCCCGGGGGCCCAGGAGCTGG + Intronic
1163091471 19:15023005-15023027 GTTGCCGCTGGCGCAGGCGCAGG - Exonic
1163103119 19:15109334-15109356 GGCCCCGGGGGCTCAGGTGCTGG - Exonic
1163173543 19:15549242-15549264 GCTCCCTGGGGCGCAGGGGAGGG - Intronic
1163243405 19:16077381-16077403 GGCCCCGGGAACGCTGGCGCGGG + Intronic
1163546460 19:17943807-17943829 CGTTCCGGGGGCCAAGGCGCCGG + Exonic
1163551180 19:17967171-17967193 GGGCCCGGGGGCGGCGGGGCCGG - Intronic
1163708630 19:18832390-18832412 GGCCCGGGCGGCGCGGGCGCGGG + Exonic
1165061369 19:33206796-33206818 GGTCCAGGGGTCACAGGAGCAGG + Intronic
1165157623 19:33797528-33797550 GGTCCCGGGCGCGCAGGGTTTGG + Intronic
1165253618 19:34559349-34559371 GGTCCCGGGGGAGGGGGTGCCGG + Intergenic
1165300202 19:34963831-34963853 GGGGCCCGGGGCGCAGGCTCCGG + Exonic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1165349830 19:35269387-35269409 GGGGGCGGGGGCGCGGGCGCGGG + Intronic
1165406292 19:35633154-35633176 GGTCCAGGGGGCCCAGGCAGAGG - Exonic
1165443566 19:35844427-35844449 GTTCCTGGGGGAGCAGGTGCTGG - Exonic
1165775727 19:38403347-38403369 TGTCCCGGGGGCGGCGTCGCGGG + Exonic
1166078022 19:40425408-40425430 GGACCCGGGGGCGGAGTCGGGGG - Intronic
1166098146 19:40554450-40554472 GGGCCTGGGGGCGCTGGAGCCGG + Intronic
1166306854 19:41940246-41940268 GAGCCCGGGGGCGGAGGGGCGGG + Intergenic
1166373648 19:42315538-42315560 GGTCCTGGGGGAGGAGGGGCTGG + Intronic
1166373678 19:42315613-42315635 GGTCCTGGGGGAGAAGGGGCTGG + Intronic
1166808135 19:45499072-45499094 GTTCCCGGGGTCGAAGGGGCCGG - Exonic
1166984126 19:46649539-46649561 AGTCCCGGGGGCGCGGACGGCGG - Exonic
1167085286 19:47305437-47305459 CCTCCAGGGGGCGCAGGAGCGGG - Intronic
1167258159 19:48443167-48443189 GGCACGGGGGGCGCAGGCGGAGG + Exonic
1167277173 19:48545525-48545547 GTTCCCGAGGGGGCAGGGGCTGG - Intergenic
1167748569 19:51367049-51367071 GGTCGTGGGGACGCAGGCACGGG - Intronic
1168124805 19:54277494-54277516 GGTCCCGGGGAGGCAGGGGTGGG - Intronic
1168297303 19:55383739-55383761 GGGCCCGGGGCGGCGGGCGCGGG - Exonic
1168332984 19:55580491-55580513 GGTCCCGGTGGAGGAGGGGCTGG + Intronic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
1168465118 19:56595455-56595477 GGTCCAGGGCGTGCGGGCGCAGG + Intronic
926130828 2:10302523-10302545 GGGGCGGGGGGCGCGGGCGCAGG + Intergenic
929053667 2:37858093-37858115 GGTGCCGGGGACCCAGGCTCAGG - Intergenic
929777792 2:44939315-44939337 GGAGCCGGGGACCCAGGCGCCGG - Intergenic
932039483 2:68284077-68284099 GGTCCCGTGGGGGCAGGAGATGG - Intergenic
932329452 2:70889368-70889390 GGTCCTGGGGGTGCGAGCGCGGG - Intergenic
932765309 2:74465372-74465394 GGAGGCGGAGGCGCAGGCGCTGG - Exonic
933759683 2:85665109-85665131 GGACCCTGGGGCTCAGGCTCAGG - Intronic
933849750 2:86356373-86356395 GGGCCAGGGGGAGCAGGTGCAGG + Intergenic
934501140 2:94861421-94861443 GGTCCCAGGGGCGCGGCCTCAGG - Intergenic
934661313 2:96145093-96145115 GGTCCGCGGGGAGCTGGCGCGGG - Exonic
934846392 2:97663784-97663806 GCCCCCGGGGGCGCACGCGGCGG - Intronic
934993328 2:98936347-98936369 GGGGCGGGGGGCGCAGGCGCCGG + Intergenic
935594315 2:104867597-104867619 AGCCCCGCGGGCCCAGGCGCGGG - Intergenic
936392526 2:112088022-112088044 GCCCCCGGGGGCCCAGGCTCAGG + Intronic
936556912 2:113503918-113503940 GGTCCAAGGGGCGCGGGGGCCGG + Intergenic
936566142 2:113584041-113584063 GGACCCGGAGGCGCGGGCGGAGG + Intergenic
938364670 2:130725669-130725691 GGGCCCGGGGGCGGGGGGGCTGG + Intergenic
938392410 2:130916232-130916254 GGACGCGGGGGCGCTGGCCCCGG - Intronic
938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG + Intronic
940049721 2:149449386-149449408 GGGCCCGGGGGTACAGGCGAAGG - Intronic
941104901 2:161341135-161341157 CGGCTCGGGGGCGCAGGGGCGGG + Intronic
941104927 2:161341196-161341218 GGTTCCGGGGGCGCGCGGGCAGG + Intronic
941314344 2:163973792-163973814 GGTCAGGGGGGCGCGGGCTCTGG + Intergenic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
944676153 2:202035149-202035171 GGCTCCGGGGGCCCAGGCGGCGG + Exonic
945241578 2:207681529-207681551 CGTCCCGGAGGCGGCGGCGCAGG + Intergenic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
946401764 2:219472122-219472144 GGGCCTGGGGGCTCAGCCGCAGG - Intronic
947229585 2:227871604-227871626 GGACGCGGGTGCGCATGCGCAGG - Exonic
947632295 2:231662121-231662143 GGCGCCCAGGGCGCAGGCGCCGG - Intergenic
947641020 2:231707998-231708020 GGTCCAAGGCGCCCAGGCGCGGG + Intronic
948746225 2:240095905-240095927 GGGCCCGCGGGTGCAGGGGCTGG + Intergenic
948843648 2:240672619-240672641 GGCCCCGGGGGTGCAAGCGGTGG + Intergenic
949040089 2:241844055-241844077 GGGCGCGGGGGCGCGGGCGTGGG + Intergenic
949046955 2:241876734-241876756 GGCCCCGGGGGCGCAACTGCAGG + Intergenic
1168800878 20:642566-642588 GGTCCCGGCGGCGGACGCGCGGG + Intergenic
1169013498 20:2271951-2271973 GGTGCCTGGGGCGCAGGAGAGGG + Intergenic
1169278644 20:4249418-4249440 GGTCCGGGGGGCTGCGGCGCTGG + Intergenic
1170026151 20:11891225-11891247 GGTGCCGGGGGCGGAGGGGCAGG + Intronic
1170226315 20:13995364-13995386 GGGCCCCAGGGCGCACGCGCAGG - Exonic
1171223517 20:23421477-23421499 GGCCGCAGGGACGCAGGCGCAGG + Exonic
1171439451 20:25148538-25148560 GGCCCTGGGGGCGCTGTCGCAGG - Intergenic
1171444729 20:25195607-25195629 GGACCCAGTTGCGCAGGCGCGGG - Intergenic
1171823251 20:29874399-29874421 GACCCCGAGGGCGCAGGCACGGG + Intergenic
1171892341 20:30728220-30728242 GGTCCCAGGGGCGCGGCCTCAGG - Intergenic
1171896846 20:30815913-30815935 GACCCCGAGGGCGAAGGCGCGGG - Intergenic
1172118110 20:32583683-32583705 GGTCCCGGCGGGGGAGCCGCGGG + Intronic
1172209526 20:33187116-33187138 GGACCCCGGGGCGCAGCCTCAGG + Intergenic
1172529312 20:35619120-35619142 GGGCGCGGGGGCGCGGGGGCTGG - Intronic
1172765081 20:37346642-37346664 GGGCCGGGGGGCGCAGGGCCGGG - Intronic
1173139606 20:40470696-40470718 ACTCCCAGGGGGGCAGGCGCTGG - Intergenic
1173251564 20:41366565-41366587 GCTCTCGGGGGCGCAGGCCAGGG - Exonic
1173872732 20:46351953-46351975 GGGCCCTGGGGTGCAGGAGCTGG + Intronic
1174287750 20:49484130-49484152 GGCGCCGGGGGCGCGGGGGCAGG + Intergenic
1175193811 20:57228715-57228737 GGTCCCAGGGGCTCAGGCCTGGG + Intronic
1175441212 20:58993463-58993485 GGACCTGGGGGTGCAGGAGCTGG - Exonic
1175697059 20:61110643-61110665 GGTCTAGGGGGCACAGGCACAGG - Intergenic
1175715421 20:61252128-61252150 GGCGCGGGGGGCGCGGGCGCGGG + Intergenic
1175877897 20:62238893-62238915 GGTCCCGGGATCGCAGTTGCCGG - Intronic
1176194373 20:63830754-63830776 GGTGCCGGGGGCCGAGGGGCCGG + Intronic
1176521757 21:7829733-7829755 GGACCCGGGGGGGCCGGGGCTGG - Intronic
1178655777 21:34459745-34459767 GGACCCGGGGGGGCCGGGGCTGG - Intergenic
1178680518 21:34669589-34669611 GGGCCCGGAGGCCGAGGCGCGGG + Exonic
1179106396 21:38404466-38404488 GGGCCCGGGGGAGAAGGAGCAGG + Intronic
1179444225 21:41420280-41420302 GGGGGCGGGGGCGCGGGCGCGGG + Intergenic
1179977032 21:44874027-44874049 GTTCCCCGCCGCGCAGGCGCAGG - Intergenic
1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG + Intergenic
1180733766 22:18001048-18001070 AGTTCCGGGGCAGCAGGCGCGGG - Intronic
1181121672 22:20671206-20671228 GGGCCCGGGGGCGCGGGCCGGGG - Intergenic
1181924220 22:26345207-26345229 GGTCCCTGGGGTACAGGCCCTGG + Intronic
1182237006 22:28883820-28883842 GGCCGCGGGGGCGGCGGCGCAGG - Exonic
1182368350 22:29793510-29793532 GGTCTGGGGGGCTCAGGGGCTGG + Intronic
1183744737 22:39685931-39685953 GGCCCCGGCCGCGCAGGCTCAGG - Exonic
1184184662 22:42856864-42856886 GTTCCCGGGGGCGGCGGCGCGGG - Intronic
1184676291 22:46045083-46045105 TGTCCCGGGGTGGCGGGCGCCGG + Intergenic
1184759567 22:46537033-46537055 GGGCCGGAGGGCGAAGGCGCGGG + Exonic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1185272510 22:49935644-49935666 GGTCCGGGAGGAGCAGGGGCGGG + Intergenic
1185365184 22:50433904-50433926 AGGGCCGGGGGCGCAGACGCTGG + Intronic
1185365269 22:50434152-50434174 AGGGCCGGGGGCGCAGACGCTGG + Intronic
949993740 3:9600672-9600694 GGGCCGGGGGGCGGGGGCGCTGG + Intergenic
950125028 3:10505609-10505631 GGGGCGGGGGGCGGAGGCGCCGG + Intronic
950531372 3:13554026-13554048 GGCTCCGGGGGCTCAGGCCCAGG - Intronic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
953982169 3:47418399-47418421 GGCCCGGGCGGCGGAGGCGCGGG - Exonic
956605008 3:71065080-71065102 GGGCCGGGGCGCGCGGGCGCGGG - Intronic
958714674 3:97764940-97764962 AGTCCGGAGGGCGCAGGAGCTGG - Exonic
961165967 3:124764151-124764173 GGTCATGGGGGCAGAGGCGCTGG - Intronic
961270177 3:125682234-125682256 GGAGCCGGGGGCGTAGGCTCAGG - Intergenic
961688284 3:128650502-128650524 GGTCCCGGGAGCGGCGGCGAGGG + Intronic
961929370 3:130517095-130517117 GGGCCCGGGGCCGCCGGGGCGGG + Intergenic
963133217 3:141876948-141876970 GGTCCCGGGGGCGCCGGGCGCGG + Intronic
965531025 3:169769637-169769659 AGTCCTGGGGGCGCAGGCAGGGG + Exonic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
966866500 3:184261440-184261462 GGCCCGGGAGGCGGAGGCGCGGG - Exonic
968092668 3:195908707-195908729 GGACCCGGAGGCGCCGGCGGAGG - Intronic
968479185 4:826258-826280 GGACCCGGGGGCGGGGGCGGAGG + Intergenic
968479232 4:826332-826354 GGACCCGGGGGCGGGGGCGGGGG + Intergenic
968479286 4:826417-826439 GGACCCGGGGGCGGGGGCGGGGG + Intergenic
968479329 4:826484-826506 GGACCCGGGGGCGGGGGCGGGGG + Intergenic
968555073 4:1242716-1242738 GGTCATGGGGGCTCAGGCGCAGG - Intronic
968653059 4:1767544-1767566 GGTCCCGGGCGCGAGGCCGCCGG + Intergenic
968902855 4:3439396-3439418 GGTTCCGGGGGCCCAGGGCCGGG + Intronic
969537665 4:7766696-7766718 GGTGCCCGAGGGGCAGGCGCTGG - Intronic
969662867 4:8540570-8540592 GGTTCCGGTGGGGCAGGGGCGGG + Intergenic
970664307 4:18319337-18319359 GGTGCTGGGGGAGCAGGAGCGGG + Intergenic
972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG + Intronic
973759066 4:54100579-54100601 GGCAGCGGGGGCGCAGGGGCCGG + Exonic
973888400 4:55346139-55346161 GGTCCTGGTCGCGCTGGCGCTGG - Exonic
975701980 4:77075635-77075657 GGATCGGGGGGCGCGGGCGCGGG + Exonic
975973754 4:80072683-80072705 GGTCCCGCTGCCGCAGGCGCCGG - Intronic
976743381 4:88379229-88379251 GGGCGCGGGGGCCCAGGTGCAGG + Intronic
977257581 4:94758047-94758069 GGAGCCGGGAGCGCAGCCGCGGG + Intronic
979582753 4:122379466-122379488 GGGCGCGGGGGCGCAAGCCCGGG + Intronic
980923926 4:139115413-139115435 CGTCCCGGAGGCGGTGGCGCAGG - Intronic
982042470 4:151409359-151409381 GGTCCCGGGGACGCCTGCGCGGG - Exonic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
985444695 4:190015470-190015492 GACCCCGAGGGCGCAGGCGCGGG + Intergenic
985483751 5:137238-137260 GGTGCCAGGGGCTCAGGGGCAGG + Intergenic
985727541 5:1523957-1523979 CGGGCCGGGCGCGCAGGCGCGGG + Exonic
985894028 5:2738734-2738756 GGTCCCGGAGGCACAGGAGGAGG - Intergenic
985894180 5:2739314-2739336 GGTCCTGGGGGCGGCGGTGCCGG + Intergenic
985946423 5:3188215-3188237 GTTCCCGCGGGCGCAGCCGAGGG + Intergenic
986306651 5:6521487-6521509 GGTCAGGGTGGCGCAGCCGCAGG + Intergenic
990175991 5:53109543-53109565 GGGCCCGGGGGCGGGGGCGGGGG + Exonic
992542211 5:77776344-77776366 GGTCGCCGGCGCGCATGCGCAGG + Exonic
992561653 5:77958200-77958222 GCTGCCCGGGGCGGAGGCGCGGG - Intergenic
993899911 5:93578476-93578498 GCTCCCGGGAGCCCAGGCCCCGG + Intergenic
994043618 5:95284659-95284681 GGTCCCCGCGGCGCTGGCGGTGG + Intergenic
994736452 5:103562551-103562573 GGTTTGGTGGGCGCAGGCGCGGG - Intronic
996308545 5:122077772-122077794 GGTCCCGGCGGCGCTGAGGCTGG + Exonic
997980512 5:138465214-138465236 GGTCCCGGAGGCCCCGGCGGCGG + Intergenic
999248345 5:150167174-150167196 GGCCCAGGGGGCGCCGGCACCGG - Exonic
999365484 5:151020883-151020905 GGTCCCGGCGGCGGAGGGGGCGG - Intronic
999696235 5:154190637-154190659 GGGCCCGGGGGCGGTGGCGGCGG + Intronic
1000041212 5:157486480-157486502 AGTCCCAGGGGTGCAGGTGCAGG + Intronic
1000302946 5:159972298-159972320 CGGCCGGGGGGCTCAGGCGCGGG - Exonic
1000343919 5:160298511-160298533 AGGCCCAGGGGAGCAGGCGCTGG - Intronic
1002599601 5:180346657-180346679 GGCCCCAGGGGCGCACGCACTGG - Intronic
1002691443 5:181053264-181053286 GGTCCTCGCGGCGCTGGCGCTGG + Exonic
1002719118 5:181247123-181247145 GGTCCGGCGGGCGCAGGCACAGG - Intronic
1003095561 6:3140396-3140418 GGACCCGGGGCAGCAGGTGCCGG - Exonic
1004690436 6:17987990-17988012 GGCCCCGCGGGCGCCGGTGCAGG - Intergenic
1005465276 6:26106958-26106980 GGACCAGGGGGTGCAGGGGCTGG + Intergenic
1006907391 6:37541988-37542010 GGTCCCTGGGGGGGAGGCCCAGG + Intergenic
1011517376 6:88167456-88167478 GGCCCCGGGGGCGGAGGGGAGGG - Intergenic
1014045220 6:116877167-116877189 GGACCCGGGGCCGCAGGGGCGGG - Intergenic
1015492122 6:133838100-133838122 AGCCCCCGGGGAGCAGGCGCGGG - Intergenic
1015776819 6:136822818-136822840 GGGCCGGGGGGCGGAGGCGGAGG + Intronic
1019294670 7:267389-267411 GGTCCTGGGGAGGCAGGAGCAGG - Intergenic
1019421978 7:954791-954813 GGTCCCCGGGGCGCGCGGGCTGG - Intronic
1019537580 7:1537277-1537299 GGGCCCGGGGGCCCAGGAGCGGG + Intronic
1020275496 7:6622266-6622288 GGTCCCGGGGGCTCCGGCCGCGG + Exonic
1020445241 7:8261709-8261731 GGTCCTGGGGCCGGAGCCGCCGG + Intronic
1021452784 7:20798081-20798103 GGAGGCGGAGGCGCAGGCGCCGG + Intergenic
1021992595 7:26152436-26152458 GGTCCCGGCGCCCCAGCCGCCGG - Exonic
1022097093 7:27147910-27147932 GGTCCCCGGGGAGCGGGCTCCGG - Intronic
1022141828 7:27499583-27499605 GGTCCAGGAGGGGCAGGCACGGG - Intergenic
1023038378 7:36152787-36152809 GGCCCCGGGAGCGCAGAGGCGGG - Intergenic
1024091022 7:45939838-45939860 GGTCGAGGGGGTGCAGGAGCCGG + Intergenic
1024151425 7:46575723-46575745 GGTTCCGGGGGCACATGTGCAGG - Intergenic
1026574454 7:71560569-71560591 GGTCCTAGTGGCGCAGGCACAGG + Intronic
1027228620 7:76260098-76260120 GGTCCTGGGGGAGAAGGGGCGGG - Exonic
1027926776 7:84475100-84475122 GGTCCCAGGAGTGCAGGGGCTGG + Intronic
1028585552 7:92447847-92447869 GGCAGCGGGGGCGCAGGCTCGGG + Exonic
1029110521 7:98211285-98211307 GGTCCGGGAGCCCCAGGCGCCGG + Intergenic
1031043468 7:116862656-116862678 AGTCGCGGGGGCGACGGCGCGGG + Intronic
1031531926 7:122886389-122886411 AGACCCGCGGGCGCAGCCGCCGG - Intronic
1032787454 7:135211755-135211777 GGTCCTGGCGGCGCCGGCGGCGG + Intergenic
1034147043 7:148883532-148883554 GGTCCCGGGCGCGCCGACCCCGG - Intronic
1034306295 7:150047701-150047723 CGGCCCGCGGGCGCAGGCGGCGG - Intergenic
1034324614 7:150219786-150219808 TCTCCCGCGGGCGCTGGCGCTGG - Intergenic
1034347622 7:150397108-150397130 GGTCCCGGGCGTGCGCGCGCTGG - Exonic
1034446085 7:151115013-151115035 GGCCCCGGCGGCCGAGGCGCGGG - Intronic
1034768580 7:153749445-153749467 TCTCCCGCGGGCGCTGGCGCTGG + Intergenic
1034800552 7:154052952-154052974 CGGCCCGCGGGCGCAGGCGGCGG + Intronic
1035299491 7:157887750-157887772 GGTACTGGGGGAGCAGGCACTGG - Intronic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1035580641 8:737599-737621 GGCGCCGAGTGCGCAGGCGCCGG + Intronic
1035613953 8:988759-988781 GGTCCCCGGGGGACAGGCCCTGG - Intergenic
1036708068 8:11059720-11059742 GGTCCGGGGGGCGCGGGCCGGGG - Intronic
1037928847 8:22865548-22865570 GGTGCCGGTGCCGCAGCCGCCGG + Intronic
1038533785 8:28339405-28339427 GGTGCAGGGTGCGCCGGCGCTGG - Exonic
1043148337 8:76682468-76682490 GCTCTCGGCGGCGCGGGCGCGGG + Intronic
1043929047 8:86069574-86069596 GGTCCCGGGGCCACCAGCGCTGG - Exonic
1046277766 8:111985611-111985633 GGCCCCGGTGGCGTAGGCACCGG - Intergenic
1047748093 8:127860188-127860210 GGTCCTGGTGGCGGAGGTGCTGG + Intergenic
1048338700 8:133522587-133522609 GGTCCAGGGTGCTGAGGCGCTGG + Intronic
1049004616 8:139846819-139846841 GGCCCAGGGTGAGCAGGCGCAGG + Intronic
1049541356 8:143210601-143210623 GAGCCCAGGGGCGCAGGTGCAGG + Intergenic
1049585410 8:143430512-143430534 GGGCGGGGGGGCGCCGGCGCGGG + Intergenic
1049761433 8:144333669-144333691 GGGCCAGGGGCCGCAGGTGCTGG - Exonic
1049762196 8:144336651-144336673 GCCCCCGGGGGCGGCGGCGCCGG + Intergenic
1049896088 9:113383-113405 GGTCCAAGGGGCGCGGGGGCCGG - Intergenic
1051893524 9:21966348-21966370 GGTCCAGTGGGCACAGGCCCAGG - Intronic
1052765377 9:32635089-32635111 GGTCCCGGGGGTGGAGGTGGAGG + Exonic
1053139881 9:35675849-35675871 GTTCCAGGGGGCGCAGGGCCGGG - Exonic
1053153406 9:35757009-35757031 GGTCCTGGGGGCGCGGTGGCTGG + Exonic
1053749472 9:41237210-41237232 GACCCCGAGGGTGCAGGCGCGGG - Intergenic
1054254917 9:62802090-62802112 GACCCCGAGGGTGCAGGCGCGGG - Intergenic
1054356482 9:64067516-64067538 GGTCCCAGGGGCGCGGCCTCAGG + Intergenic
1054835573 9:69672290-69672312 GGTCCCGGCGGCGGCGGCGGCGG - Exonic
1055611763 9:78031543-78031565 GTTCCCGGGGAAGGAGGCGCGGG - Intergenic
1055612032 9:78032441-78032463 GCTCCCTGCGGCGCCGGCGCTGG + Intergenic
1056170674 9:83981096-83981118 GGGCCCGGGGGCGCAGCTGGCGG + Intronic
1057245609 9:93451890-93451912 GGCGGCGGGGGCGCGGGCGCGGG - Exonic
1057436830 9:95048452-95048474 GGGGCCTGGGGCGCAGGGGCGGG + Intronic
1057669646 9:97076853-97076875 TGCCCCGTGGGCGCAGGAGCAGG - Intergenic
1057758490 9:97854663-97854685 GGTAGCGGGGGCGCCGGCGGAGG - Exonic
1057881530 9:98796304-98796326 GGGCCCGGGGCCGCAGCGGCGGG - Exonic
1057922060 9:99105393-99105415 GGGGCCGGGGGCGCAGGTGGCGG + Intronic
1058885433 9:109319307-109319329 GGTGCCCGGGACGCAGGCCCAGG + Intronic
1058967156 9:110048821-110048843 GCTCCCGGGGGCGCAGTCCTGGG - Exonic
1059732829 9:117073747-117073769 GGGCCTGGGGGAGCAGGCGGTGG + Intronic
1060484969 9:124041066-124041088 GGTCCCGGGGGAGCCGGCCCGGG + Intergenic
1060894034 9:127206142-127206164 CATCCAGGGTGCGCAGGCGCAGG + Intronic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1061275928 9:129569272-129569294 GGGGGCGGGGGCGCGGGCGCGGG + Intergenic
1061293593 9:129665835-129665857 GGCCCCGGGGGGGCCGGCGGGGG - Exonic
1061366024 9:130172781-130172803 GGTCCGGGGGGCGGGGGCGGGGG - Intronic
1061407099 9:130398500-130398522 GGTGCAGGGGGCACAGGGGCTGG - Intronic
1061582303 9:131545640-131545662 GGTGCCGGAGGGGCAGGTGCTGG + Intergenic
1061779980 9:132989703-132989725 GGCCCCGGGGGGTCAGGTGCAGG - Intronic
1061947399 9:133916418-133916440 GGGCCCGGGCGCACAGGCCCAGG + Intronic
1062004486 9:134232327-134232349 GGGCCCGGGGGAGCAGGAGGGGG - Intergenic
1062116779 9:134813864-134813886 GGTCCTGGGTGCCCAGGGGCAGG + Intronic
1062378573 9:136275978-136276000 TGTCCTGGGGGCGCTGGCACTGG - Intergenic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1062626038 9:137441841-137441863 GGTCCCGGGGCCGCCGCCGTCGG + Intergenic
1203748019 Un_GL000218v1:54233-54255 GGTCCCAGGGGCGCGGCCTCAGG + Intergenic
1203376322 Un_KI270442v1:380932-380954 GACCCCGAGGGCGCAGGCGCGGG + Intergenic
1203561707 Un_KI270744v1:63740-63762 GGTCCCAGGGGCGCGGCCTCAGG - Intergenic
1188683499 X:33041286-33041308 GGTCGCCGGCGCGCATGCGCAGG - Intronic
1189187922 X:39070147-39070169 GCTCCCGGGAGCGCCGGTGCGGG - Intergenic
1189407102 X:40735309-40735331 GCTCCCGGGGGAGGAGGGGCTGG + Exonic
1192468442 X:71375226-71375248 GGTCCCGGGGGTGGAGGTGGAGG - Exonic
1192488026 X:71547686-71547708 GGTTCTGGTGGCGCAGGCGCAGG + Intronic
1192533732 X:71911117-71911139 GGTTGCGCGGGCACAGGCGCTGG - Intergenic
1196645886 X:118116909-118116931 GGCCCCGGCGGCGCCTGCGCGGG + Intronic
1198302402 X:135344867-135344889 GTTCCCTGGGGCGCGGGCGCGGG + Intronic
1198321300 X:135521234-135521256 GGTCCCGGGCGCGCAGCTGCGGG - Exonic
1200058752 X:153474725-153474747 GGGGGCGGGGGCGCGGGCGCTGG + Intronic