ID: 1129052391

View in Genome Browser
Species Human (GRCh38)
Location 15:72793310-72793332
Sequence CAGAGCAAAGACTCTTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129052391_1129052394 -5 Left 1129052391 15:72793310-72793332 CCTTCCTAAGAGTCTTTGCTCTG No data
Right 1129052394 15:72793328-72793350 CTCTGGCTCTTACTTTCATCTGG No data
1129052391_1129052395 27 Left 1129052391 15:72793310-72793332 CCTTCCTAAGAGTCTTTGCTCTG No data
Right 1129052395 15:72793360-72793382 TGACTTGATCTTTGCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129052391 Original CRISPR CAGAGCAAAGACTCTTAGGA AGG (reversed) Intergenic
No off target data available for this crispr