ID: 1129052765

View in Genome Browser
Species Human (GRCh38)
Location 15:72796742-72796764
Sequence CCCCATCTGCAGAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129052759_1129052765 -3 Left 1129052759 15:72796722-72796744 CCGTCTCTGAACCTCGGTTTCCC No data
Right 1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG No data
1129052756_1129052765 25 Left 1129052756 15:72796694-72796716 CCTCTTCGTGCGGTGGATGCATC No data
Right 1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129052765 Original CRISPR CCCCATCTGCAGAATGGGGA TGG Intergenic
No off target data available for this crispr