ID: 1129055443

View in Genome Browser
Species Human (GRCh38)
Location 15:72816803-72816825
Sequence CTGTTACACCAAAAGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129055436_1129055443 15 Left 1129055436 15:72816765-72816787 CCCAAACAAGTTGTGTCAGAGAA No data
Right 1129055443 15:72816803-72816825 CTGTTACACCAAAAGGTGTGGGG No data
1129055437_1129055443 14 Left 1129055437 15:72816766-72816788 CCAAACAAGTTGTGTCAGAGAAT No data
Right 1129055443 15:72816803-72816825 CTGTTACACCAAAAGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129055443 Original CRISPR CTGTTACACCAAAAGGTGTG GGG Intergenic
No off target data available for this crispr