ID: 1129055721

View in Genome Browser
Species Human (GRCh38)
Location 15:72818687-72818709
Sequence GTGGGTGACCACTTGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129055721_1129055727 0 Left 1129055721 15:72818687-72818709 CCCTGCTGCAAGTGGTCACCCAC No data
Right 1129055727 15:72818710-72818732 TGAGGCTTTGTCGGATCAGATGG No data
1129055721_1129055728 16 Left 1129055721 15:72818687-72818709 CCCTGCTGCAAGTGGTCACCCAC No data
Right 1129055728 15:72818726-72818748 CAGATGGATTTGTATAATTTAGG No data
1129055721_1129055724 -9 Left 1129055721 15:72818687-72818709 CCCTGCTGCAAGTGGTCACCCAC No data
Right 1129055724 15:72818701-72818723 GTCACCCACTGAGGCTTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129055721 Original CRISPR GTGGGTGACCACTTGCAGCA GGG (reversed) Intergenic
No off target data available for this crispr