ID: 1129055721 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:72818687-72818709 |
| Sequence | GTGGGTGACCACTTGCAGCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1129055721_1129055727 | 0 | Left | 1129055721 | 15:72818687-72818709 | CCCTGCTGCAAGTGGTCACCCAC | No data | ||
| Right | 1129055727 | 15:72818710-72818732 | TGAGGCTTTGTCGGATCAGATGG | No data | ||||
| 1129055721_1129055728 | 16 | Left | 1129055721 | 15:72818687-72818709 | CCCTGCTGCAAGTGGTCACCCAC | No data | ||
| Right | 1129055728 | 15:72818726-72818748 | CAGATGGATTTGTATAATTTAGG | No data | ||||
| 1129055721_1129055724 | -9 | Left | 1129055721 | 15:72818687-72818709 | CCCTGCTGCAAGTGGTCACCCAC | No data | ||
| Right | 1129055724 | 15:72818701-72818723 | GTCACCCACTGAGGCTTTGTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1129055721 | Original CRISPR | GTGGGTGACCACTTGCAGCA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||