ID: 1129055724

View in Genome Browser
Species Human (GRCh38)
Location 15:72818701-72818723
Sequence GTCACCCACTGAGGCTTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129055721_1129055724 -9 Left 1129055721 15:72818687-72818709 CCCTGCTGCAAGTGGTCACCCAC No data
Right 1129055724 15:72818701-72818723 GTCACCCACTGAGGCTTTGTCGG No data
1129055720_1129055724 -2 Left 1129055720 15:72818680-72818702 CCAGGAGCCCTGCTGCAAGTGGT No data
Right 1129055724 15:72818701-72818723 GTCACCCACTGAGGCTTTGTCGG No data
1129055718_1129055724 1 Left 1129055718 15:72818677-72818699 CCACCAGGAGCCCTGCTGCAAGT No data
Right 1129055724 15:72818701-72818723 GTCACCCACTGAGGCTTTGTCGG No data
1129055722_1129055724 -10 Left 1129055722 15:72818688-72818710 CCTGCTGCAAGTGGTCACCCACT No data
Right 1129055724 15:72818701-72818723 GTCACCCACTGAGGCTTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129055724 Original CRISPR GTCACCCACTGAGGCTTTGT CGG Intergenic
No off target data available for this crispr