ID: 1129055725

View in Genome Browser
Species Human (GRCh38)
Location 15:72818705-72818727
Sequence TGATCCGACAAAGCCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129055725_1129055732 24 Left 1129055725 15:72818705-72818727 CCCACTGAGGCTTTGTCGGATCA No data
Right 1129055732 15:72818752-72818774 CTTCTATCTCCAGCTCTAGCTGG No data
1129055725_1129055728 -2 Left 1129055725 15:72818705-72818727 CCCACTGAGGCTTTGTCGGATCA No data
Right 1129055728 15:72818726-72818748 CAGATGGATTTGTATAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129055725 Original CRISPR TGATCCGACAAAGCCTCAGT GGG (reversed) Intergenic
No off target data available for this crispr