ID: 1129056724

View in Genome Browser
Species Human (GRCh38)
Location 15:72825769-72825791
Sequence GCCAATGAGACTATAGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129056724_1129056732 19 Left 1129056724 15:72825769-72825791 CCCTTAGCTATAGTCTCATTGGC No data
Right 1129056732 15:72825811-72825833 CAGAGGGGACAACATTTCCCAGG No data
1129056724_1129056726 -7 Left 1129056724 15:72825769-72825791 CCCTTAGCTATAGTCTCATTGGC No data
Right 1129056726 15:72825785-72825807 CATTGGCCTCAGAGCTGCTCTGG No data
1129056724_1129056729 3 Left 1129056724 15:72825769-72825791 CCCTTAGCTATAGTCTCATTGGC No data
Right 1129056729 15:72825795-72825817 AGAGCTGCTCTGGAGCCAGAGGG No data
1129056724_1129056728 2 Left 1129056724 15:72825769-72825791 CCCTTAGCTATAGTCTCATTGGC No data
Right 1129056728 15:72825794-72825816 CAGAGCTGCTCTGGAGCCAGAGG No data
1129056724_1129056730 4 Left 1129056724 15:72825769-72825791 CCCTTAGCTATAGTCTCATTGGC No data
Right 1129056730 15:72825796-72825818 GAGCTGCTCTGGAGCCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129056724 Original CRISPR GCCAATGAGACTATAGCTAA GGG (reversed) Intergenic
No off target data available for this crispr