ID: 1129059571

View in Genome Browser
Species Human (GRCh38)
Location 15:72849905-72849927
Sequence TGGTGCCTTCTCAGGCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129059569_1129059571 -7 Left 1129059569 15:72849889-72849911 CCATGGCAACGGAATCTGGTGCC No data
Right 1129059571 15:72849905-72849927 TGGTGCCTTCTCAGGCTGTCTGG No data
1129059565_1129059571 20 Left 1129059565 15:72849862-72849884 CCTTGTGCTCTAACTTTGCTTCT No data
Right 1129059571 15:72849905-72849927 TGGTGCCTTCTCAGGCTGTCTGG No data
1129059564_1129059571 27 Left 1129059564 15:72849855-72849877 CCATGTTCCTTGTGCTCTAACTT No data
Right 1129059571 15:72849905-72849927 TGGTGCCTTCTCAGGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129059571 Original CRISPR TGGTGCCTTCTCAGGCTGTC TGG Intergenic
No off target data available for this crispr