ID: 1129060011

View in Genome Browser
Species Human (GRCh38)
Location 15:72853236-72853258
Sequence GGGCTCACAGCAGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129059999_1129060011 8 Left 1129059999 15:72853205-72853227 CCGTGCCCCAACTGCTTTCCCCA No data
Right 1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG No data
1129060005_1129060011 -10 Left 1129060005 15:72853223-72853245 CCCCAACTTCTAAGGGCTCACAG No data
Right 1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG No data
1129060002_1129060011 1 Left 1129060002 15:72853212-72853234 CCAACTGCTTTCCCCAACTTCTA No data
Right 1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG No data
1129060000_1129060011 3 Left 1129060000 15:72853210-72853232 CCCCAACTGCTTTCCCCAACTTC No data
Right 1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG No data
1129060001_1129060011 2 Left 1129060001 15:72853211-72853233 CCCAACTGCTTTCCCCAACTTCT No data
Right 1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129060011 Original CRISPR GGGCTCACAGCAGTGGAGGA GGG Intergenic
No off target data available for this crispr