ID: 1129061088

View in Genome Browser
Species Human (GRCh38)
Location 15:72860925-72860947
Sequence ATAACTGTATAACAGTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129061088_1129061090 7 Left 1129061088 15:72860925-72860947 CCATGAGACTGTTATACAGTTAT No data
Right 1129061090 15:72860955-72860977 TACCTTTTATAAATGCCCCAGGG No data
1129061088_1129061092 19 Left 1129061088 15:72860925-72860947 CCATGAGACTGTTATACAGTTAT No data
Right 1129061092 15:72860967-72860989 ATGCCCCAGGGATTCAGAAAAGG No data
1129061088_1129061089 6 Left 1129061088 15:72860925-72860947 CCATGAGACTGTTATACAGTTAT No data
Right 1129061089 15:72860954-72860976 ATACCTTTTATAAATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129061088 Original CRISPR ATAACTGTATAACAGTCTCA TGG (reversed) Intergenic
No off target data available for this crispr