ID: 1129061090

View in Genome Browser
Species Human (GRCh38)
Location 15:72860955-72860977
Sequence TACCTTTTATAAATGCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129061088_1129061090 7 Left 1129061088 15:72860925-72860947 CCATGAGACTGTTATACAGTTAT No data
Right 1129061090 15:72860955-72860977 TACCTTTTATAAATGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129061090 Original CRISPR TACCTTTTATAAATGCCCCA GGG Intergenic
No off target data available for this crispr