ID: 1129063220

View in Genome Browser
Species Human (GRCh38)
Location 15:72878262-72878284
Sequence CTGTATCCTCACATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129063217_1129063220 1 Left 1129063217 15:72878238-72878260 CCTGGTTCATACAGGGTCTTCTT No data
Right 1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG No data
1129063216_1129063220 7 Left 1129063216 15:72878232-72878254 CCATTTCCTGGTTCATACAGGGT No data
Right 1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129063220 Original CRISPR CTGTATCCTCACATGGAGGA AGG Intergenic
No off target data available for this crispr