ID: 1129067149

View in Genome Browser
Species Human (GRCh38)
Location 15:72914802-72914824
Sequence CTGTGGAAGGAGAAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129067149_1129067155 4 Left 1129067149 15:72914802-72914824 CCTTCTGCCTTCTCCTTCCACAG No data
Right 1129067155 15:72914829-72914851 CAGACCTGCATGGCAATCTGAGG No data
1129067149_1129067154 -6 Left 1129067149 15:72914802-72914824 CCTTCTGCCTTCTCCTTCCACAG No data
Right 1129067154 15:72914819-72914841 CCACAGAGGTCAGACCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129067149 Original CRISPR CTGTGGAAGGAGAAGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr