ID: 1129067514

View in Genome Browser
Species Human (GRCh38)
Location 15:72918660-72918682
Sequence CTTGATAATACACCTTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129067503_1129067514 27 Left 1129067503 15:72918610-72918632 CCCAGAATTCCCCCACAGGATTA No data
Right 1129067514 15:72918660-72918682 CTTGATAATACACCTTTTATAGG No data
1129067512_1129067514 -7 Left 1129067512 15:72918644-72918666 CCACTGTGGTACCTAGCTTGATA No data
Right 1129067514 15:72918660-72918682 CTTGATAATACACCTTTTATAGG No data
1129067504_1129067514 26 Left 1129067504 15:72918611-72918633 CCAGAATTCCCCCACAGGATTAA No data
Right 1129067514 15:72918660-72918682 CTTGATAATACACCTTTTATAGG No data
1129067507_1129067514 17 Left 1129067507 15:72918620-72918642 CCCCACAGGATTAAGCTCCAGGC No data
Right 1129067514 15:72918660-72918682 CTTGATAATACACCTTTTATAGG No data
1129067505_1129067514 18 Left 1129067505 15:72918619-72918641 CCCCCACAGGATTAAGCTCCAGG No data
Right 1129067514 15:72918660-72918682 CTTGATAATACACCTTTTATAGG No data
1129067511_1129067514 0 Left 1129067511 15:72918637-72918659 CCAGGCACCACTGTGGTACCTAG No data
Right 1129067514 15:72918660-72918682 CTTGATAATACACCTTTTATAGG No data
1129067509_1129067514 15 Left 1129067509 15:72918622-72918644 CCACAGGATTAAGCTCCAGGCAC No data
Right 1129067514 15:72918660-72918682 CTTGATAATACACCTTTTATAGG No data
1129067508_1129067514 16 Left 1129067508 15:72918621-72918643 CCCACAGGATTAAGCTCCAGGCA No data
Right 1129067514 15:72918660-72918682 CTTGATAATACACCTTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129067514 Original CRISPR CTTGATAATACACCTTTTAT AGG Intergenic
No off target data available for this crispr