ID: 1129068834

View in Genome Browser
Species Human (GRCh38)
Location 15:72934149-72934171
Sequence CTGGGTTGTCAGATCAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129068832_1129068834 -5 Left 1129068832 15:72934131-72934153 CCTTCAGATGGTAGAAGTCTGGG No data
Right 1129068834 15:72934149-72934171 CTGGGTTGTCAGATCAGATGAGG No data
1129068830_1129068834 6 Left 1129068830 15:72934120-72934142 CCAAGCTGTTGCCTTCAGATGGT No data
Right 1129068834 15:72934149-72934171 CTGGGTTGTCAGATCAGATGAGG No data
1129068828_1129068834 29 Left 1129068828 15:72934097-72934119 CCAAGTCACAAAACTTTAACATG No data
Right 1129068834 15:72934149-72934171 CTGGGTTGTCAGATCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129068834 Original CRISPR CTGGGTTGTCAGATCAGATG AGG Intergenic
No off target data available for this crispr