ID: 1129070132 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:72944048-72944070 |
| Sequence | TCTTTCTTCTGAATTGGAAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1129070132_1129070140 | 17 | Left | 1129070132 | 15:72944048-72944070 | CCAGTTCCAATTCAGAAGAAAGA | No data | ||
| Right | 1129070140 | 15:72944088-72944110 | TAGCTTCAGAGAAAATCCAAGGG | No data | ||||
| 1129070132_1129070139 | 16 | Left | 1129070132 | 15:72944048-72944070 | CCAGTTCCAATTCAGAAGAAAGA | No data | ||
| Right | 1129070139 | 15:72944087-72944109 | ATAGCTTCAGAGAAAATCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1129070132 | Original CRISPR | TCTTTCTTCTGAATTGGAAC TGG (reversed) | Intergenic | ||