ID: 1129070132

View in Genome Browser
Species Human (GRCh38)
Location 15:72944048-72944070
Sequence TCTTTCTTCTGAATTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129070132_1129070139 16 Left 1129070132 15:72944048-72944070 CCAGTTCCAATTCAGAAGAAAGA No data
Right 1129070139 15:72944087-72944109 ATAGCTTCAGAGAAAATCCAAGG No data
1129070132_1129070140 17 Left 1129070132 15:72944048-72944070 CCAGTTCCAATTCAGAAGAAAGA No data
Right 1129070140 15:72944088-72944110 TAGCTTCAGAGAAAATCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129070132 Original CRISPR TCTTTCTTCTGAATTGGAAC TGG (reversed) Intergenic
No off target data available for this crispr