ID: 1129070139

View in Genome Browser
Species Human (GRCh38)
Location 15:72944087-72944109
Sequence ATAGCTTCAGAGAAAATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129070135_1129070139 10 Left 1129070135 15:72944054-72944076 CCAATTCAGAAGAAAGAGGGCTT No data
Right 1129070139 15:72944087-72944109 ATAGCTTCAGAGAAAATCCAAGG No data
1129070132_1129070139 16 Left 1129070132 15:72944048-72944070 CCAGTTCCAATTCAGAAGAAAGA No data
Right 1129070139 15:72944087-72944109 ATAGCTTCAGAGAAAATCCAAGG No data
1129070131_1129070139 26 Left 1129070131 15:72944038-72944060 CCACAGGCTACCAGTTCCAATTC No data
Right 1129070139 15:72944087-72944109 ATAGCTTCAGAGAAAATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129070139 Original CRISPR ATAGCTTCAGAGAAAATCCA AGG Intergenic