ID: 1129070593

View in Genome Browser
Species Human (GRCh38)
Location 15:72946878-72946900
Sequence GCATTGGTGTTAGCAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129070593_1129070599 19 Left 1129070593 15:72946878-72946900 CCTGGACCTGCTAACACCAATGC No data
Right 1129070599 15:72946920-72946942 GCCCAAAGACAGACCTTCCTAGG No data
1129070593_1129070596 -6 Left 1129070593 15:72946878-72946900 CCTGGACCTGCTAACACCAATGC No data
Right 1129070596 15:72946895-72946917 CAATGCTCATGTATGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129070593 Original CRISPR GCATTGGTGTTAGCAGGTCC AGG (reversed) Intergenic
No off target data available for this crispr