ID: 1129073439

View in Genome Browser
Species Human (GRCh38)
Location 15:72971475-72971497
Sequence GGTACTGCCCCTTTAAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129073433_1129073439 11 Left 1129073433 15:72971441-72971463 CCAGGACAGTTCAGTTAATCATA No data
Right 1129073439 15:72971475-72971497 GGTACTGCCCCTTTAAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129073439 Original CRISPR GGTACTGCCCCTTTAAGAAG TGG Intergenic
No off target data available for this crispr