ID: 1129074298

View in Genome Browser
Species Human (GRCh38)
Location 15:72978457-72978479
Sequence TTGAATAAGCTGGAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129074298_1129074301 22 Left 1129074298 15:72978457-72978479 CCTGCTTCCTCCAGCTTATTCAA No data
Right 1129074301 15:72978502-72978524 GTAGCATGATTTTGTAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129074298 Original CRISPR TTGAATAAGCTGGAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr